معلومة

إنزيم مضاد التربسين

إنزيم مضاد التربسين



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لدى مريض مدخن ، هل فرط هضم الرئة بسبب مزيج من التدخين وخلل في جين أنتيتريبسين (يمنع الهضم من البروتياز)؟ أم أن التدخين يتصرف مثل مريض يعاني من خلل في الجين؟


ويكيبيديا لديها مقال جيد عن المرض.

https://en.wikipedia.org/wiki/Alpha_1-antitrypsin_deficiency

من تلك المقالة

يتم إنتاج ألفا -1 أنتيتريبسين (A1AT) في الكبد ، وتتمثل إحدى وظائفه في حماية الرئتين من الإيلاستاز العدلات ، وهو إنزيم يمكن أن يعطل النسيج الضام.

البروتياز العدلات نشطة في أي مكان تكون فيه العدلات. يمكن للأشخاص الذين لا يدخنون أن يصابوا بمرض الانسداد الرئوي المزمن فقط من خلال الشكل المتنحي المزدوج لهذا المرض (لا يوجد مضاد التريبسين ألفا -1 النشط). ولكن إذا كان هذا هو الحال معك وأنت أيضًا مدخن ، فستصاب بمرض الانسداد الرئوي المزمن السريع. يعد مرض الانسداد الرئوي المزمن بالفعل مرضًا التهابيًا مرتبطًا بعمل المخاط والعدلات ، ولا شك أن الضرر الذي يسببه هذا يزيد مع نقص مضاد التريبسين ألفا -1 الوقائي.

إذا كنت تعاني من هذه الحالة ، يمكنك الحصول على حقن alpha-1 antitrypsin - مثل مرضى السكري من النوع 1 يحصلون على الأنسولين.


1.18: وظيفة الإنزيم

  • بمساهمة CK-12: مفاهيم علم الأحياء
  • مصدره مؤسسة CK-12

هل تحتوي الخلايا على إنزيم واحد له العديد من الوظائف ، أم العديد من الإنزيمات ، ولكل منها وظيفة واحدة فقط؟

الانزيمات. البروتينات السحرية الضرورية للحياة. إذن كيف تعمل الإنزيمات؟ كيف يحفزون تفاعل كيميائي حيوي محدد واحد فقط؟ في اللغز ، قطعتان فقط تتلاءمان معًا بشكل صحيح. يعد فهم ذلك أحد الخطوات الرئيسية في فهم كيفية عمل الإنزيمات.


الأسباب

الطفرات في سيربينا 1 يسبب نقص ألفا -1 أنتيتريبسين. يوفر هذا الجين تعليمات لصنع بروتين يسمى alpha-1 antitrypsin ، والذي يحمي الجسم من إنزيم قوي يسمى neutrophil elastase. يتم إطلاق الإيلاستاز العدلات من خلايا الدم البيضاء لمحاربة العدوى ، ولكنه يمكن أن يهاجم الأنسجة الطبيعية (خاصة الرئتين) إذا لم يتم التحكم فيه بإحكام بواسطة مضاد التريبسين alpha-1.

الطفرات في سيربينا 1 يمكن أن يؤدي الجين إلى نقص (نقص) مضاد التريبسين alpha-1 أو شكل غير طبيعي من البروتين لا يمكنه التحكم في الإيلاستاز العدلات. بدون أنتيتريبسين ألفا -1 وظيفي كافٍ ، فإن الإيلاستاز العدلات يدمر الحويصلات ويسبب أمراض الرئة. يمكن أن يتراكم مضاد التريبسين ألفا -1 غير الطبيعي أيضًا في الكبد ويتلف هذا العضو.

من المحتمل أن تؤثر العوامل البيئية ، مثل التعرض لدخان التبغ والمواد الكيميائية والغبار ، على شدة نقص alpha-1 antitrypsin.

تعرف على المزيد حول الجين المرتبط بنقص ألفا -1 أنتيتريبسين


علاج او معاملة

بشكل عام ، يشمل علاج المشكلات الطبية المرتبطة بنقص ألفا -1 أنتيتريبسين (AATD) العلاجات الطبية القياسية والرعاية الداعمة للمشكلة الطبية المحددة. ومع ذلك ، هناك علاج خاص واحد متاح لبعض الأشخاص المصابين بـ AATD الذين يعانون من مشاكل في الرئة يسمى العلاج بالتكبير (يسمى أحيانًا العلاج البديل). [2] [3] [5]

يهدف العلاج المعزز إلى زيادة مستوى الدم من بروتين ألفا -1 أنتيتريبسين (AAT) عن طريق إضافة AAT البشري المنقى مباشرة إلى دم الشخص من خلال التسريب الوريدي (IV). الهدف هو منع تطور مرض الرئة. عادة ما تتحسن مشاكل الجلد أيضًا. لا يؤثر العلاج المكثف على أمراض الكبد المرتبطة بـ AATD. [2] [3] [5]


عمل الإنزيمات - تحديد كمية بروتينات الحليب

التربسين هو إنزيم يحلل البروتينات إلى ببتيدات ، ويكون جاهزًا لأنزيمات أخرى لتخفيضها إلى الأحماض الأمينية لاستخدامها في الجسم. الإنزيمات عبارة عن محفزات ، مما يعني أنها تساعد أو تتسبب في حدوث تفاعل دون أن يتم استهلاكها بنفسها. يعمل التربسين في الأمعاء الدقيقة ، بعد أن يبدأ الحمض والبيبسين في المعدة بعمل تكسير البروتينات.

تستخدم هذه التجربة الحليب الذي يحتوي على بروتين الكازين. عندما يتفكك الكازين في الحليب ، تصبح الجزيئات الأصغر قابلة للذوبان ، مما يقلل من عتامة السائل. يمكن قياس الوقت المستغرق لتحطيم الجزيئات ومقارنة القيم المعروفة مقابل قيم غير معروفة ستسمح بحساب المجهول. نظرًا لأن الحليب لن يصبح واضحًا تمامًا بسبب الوجود الحتمي للدهون ، فسيتم إدخال بعض الأخطاء من خلال قرارات متفاوتة من نقطة النهاية ، ليس فقط بين الفصل ولكن قد يكون لكل طالب تناقضات خاصة به. يمكن استخدام مقياس الألوان في وضع النفاذية بدلاً من ذلك لتقليل هذا النوع من الخطأ ، ولكن يجب أن يكون التقييم المرئي كافيًا لإثبات المبدأ الأساسي. تبدأ هذه التجربة بتركيزات معروفة من مسحوق الحليب الخالي من الدسم. يمكن حساب تركيز البروتين نفسه إذا كنت ترغب في ذلك ، من المعلومات الموجودة على عبوة الحليب التي وجدنا أن الحليب الخالي من الدسم يحتوي بشكل عام على حوالي 9 جرام من البروتين لكل 25 جرام من المسحوق (36٪).

التحضير: فني مختبر

  1. قم بإذابة 30 جرام من مسحوق الحليب في 250 مل من الماء المقطر (dH2O)
  2. أضف الماء المقطر لعمل 300 مل من محلول مخزون 10٪. (اضبط بما يتناسب مع حجم فصلك الدراسي & ndash 300mL من المخزون يجب أن يكون كافيًا لـ 12 مجموعة مع السماح بالتسرب). تمييع كما يلي:
        • 5٪ قياسي & ndash 75 مل من المخزون في 75 مل من dH2O
        • 4٪ قياسي & ndash 60 مل من المخزون في 90 مل من dH2O
        • 3٪ قياسي & ndash 45 مل من المخزون في 105 مل من dH2O
        • 2٪ قياسي & ndash 30 مل من المخزون في 120 مل dH2O
        • 1٪ قياسي & ndash 15 مل من المخزون في 135 مل من dH2O
        1. استخدم الحليب المتبقي لإنشاء عينتين غير معروفين (X و Y) ضمن النطاق 1-5٪ على سبيل المثال 47 مل من المخزون في 103 مل من dH2O و 28 مل من المخزون في 122 مل من dH2O. احتفظ بملاحظة التركيز ولكن لا تكشف للطلاب.

        محلول مخزون التربسين:

        1. قم بإذابة 1 جرام من التربسين في 100 مل dH2O لعمل محلول 1٪.
        2. قم بإجراء فحص سريع (انظر الطريقة أدناه) للتأكد من أن معيار البروتين 5٪ سيستغرق حوالي 2-3 دقائق حتى نقطة النهاية.
        3. إذا كان التوقيت مناسبًا ، فقم بإذابة 4 جم من التربسين في 400 مل من dH2O لتحضير ما تبقى من محلول 1٪. إذا كان & rsquos سريعًا جدًا أو بطيئًا جدًا ، فاضبط التخفيف بشكل مناسب.

        الطريقة: نشاط الطالب

        1. قم بتسمية أنابيب الاختبار الخاصة بك 1٪ ، 2٪ ، 3٪ ، 4٪ ، 5٪ ، X و Y.
        2. أضف إلى كل أنبوب 10 مل من محلول الحليب المناسب.
        3. ضع علامة على صليب أسود ، بحجم قطر أنابيب الاختبار تقريبًا ، على الورقة البيضاء.
        4. أضف 5 مل من محلول التربسين إلى الأنبوب الأول (1٪). ابدأ الموقت ورجّه برفق حتى يمتزج. إذا كنت ترتدي قفازات ، فقد تفضل أن تمسك إبهامك فوق الجزء العلوي من الأنبوب وتخلط عن طريق قلب الأنبوب ، مع الحرص على أنك قمت بتغطية الجزء العلوي بالكامل.
        5. أمسك الصليب خلف أنبوب الاختبار وسجل الوقت الذي يستغرقه حتى يصبح مرئيًا.
        6. كرر مع الأنابيب المتبقية - حافظ على تناسق النقطة التي تحدد عندها الصليب ليكون مرئيًا.
        7. ارسم نتائجك للمعايير على ورقة الرسم البياني الخاصة بك للتحقق بسهولة أكبر من الحالات الشاذة. إذا كانت أي نتيجة تبدو في غير محلها وتحتاج إلى إعادة تشغيل هذا المعيار ، فمن الأفضل استخدام أنابيب اختبار نظيفة حيث قد يكون من الصعب تنظيف الإنزيم. إذا كنت بحاجة إلى إعادة استخدام الأنبوب ، فضع أولاً 5 مل من التربسين وابدأ الموقت من وقت إضافة الحليب.
        8. بمجرد اقتناعك بأن منحنى المعايرة الخاص بك منطقي ، ارسم نتائج المجهولين لتقدير تركيز الحليب في كل منهما.
        9. يجب مقارنة نتائج الفئة وتوسيطها لعمل تقدير ومنحنى معايرة إجمالي. ضع في اعتبارك ما تتوقع رؤيته من النتائج الإجمالية مقارنة بالفرد.

        الملاحظات والنتائج

        فيما يلي مثال على النتائج المتوقعة. إنه دليل فقط لأن النتائج الفردية ستختلف.


        التقسيم شبه الدقيق لمونومر وبوليمر ألفا -1 أنتيتريبسين بفصل الطرد المركزي والمعايرة بواسطة لطخة غربية للمكونات القابلة للذوبان وغير القابلة للذوبان

        نقص ألفا -1 أنتيتريبسين (a1AT) ، في شكله الكلاسيكي ، هو مرض وراثي جسمي مقهور مرتبط بزيادة خطر الإصابة بأمراض الكبد لدى البالغين والأطفال ، ومع أمراض الرئة لدى البالغين. ترتبط الغالبية العظمى من أمراض الكبد مع الزيجوت المتماثل للأليل Z mutant allele ، المعروف أيضًا باسم PiZZ. هذا الأليل متماثل الزيجوت يصنع كميات كبيرة من البروتين المتحول a1AT Z في الكبد ، لكن البروتين الطافر ينثني أيضًا بشكل غير صحيح أثناء التكوّن الحيوي. نتيجة لذلك ، يتم الاحتفاظ بحوالي 85٪ من الجزيئات داخل خلايا الكبد بدلاً من إفرازها بشكل مناسب. يؤدي انخفاض مستوى المصل أو "النقص" الناتج عن ذلك إلى جعل الرئتين عرضة للإصابة الالتهابية من البروتياز العدلات غير المحظور. يتم توجيه معظم البروتينات الطافرة Z المحتجزة داخل خلايا الكبد إلى مسارات تحلل البروتين داخل الخلايا ، ولكن تبقى بعض الجزيئات في الشبكة الإندوبلازمية لفترات طويلة من الزمن ، بينما يتبنى البعض الآخر تشكلاً مجمعًا أو "مبلمرًا" غير عادي. يُعتقد أن هذه البوليمرات داخل الخلايا تؤدي إلى سلسلة من الإصابات داخل الخلايا والتي يمكن أن تؤدي إلى إنهاء إصابة الكبد بما في ذلك التهاب الكبد المزمن وتليف الكبد وسرطان الخلايا الكبدية. من المقبول على نطاق واسع أن العامل المسبب للمرض في عوز Z-alpha-1 antitrypsin الطافر (AATD-Z) هو تراكم سام لبروتين Z المتحولة. نظرًا لأن الاختلال في تشكيل بعض وليس كل البروتين Z أثناء نضجه يؤدي إلى بلمرة متجانسة ، فإن إجراء فحص لتقييم كمية ATZ المطوية بشكل طبيعي و ATZ البوليمر المتراكم سيكون مفيدًا للغاية. نحن هنا نصف طريقة لتقييم هذين الكسرين جزئياً في نسيج أو مصدر ثقافة الخلية.

        الكلمات الدالة: AAT ATZ Aggregation Alpha-1 antitrypsin تليف الكبد أمراض الكبد البلمرة مونومر البوليمر فصل البروتين القابل للذوبان / غير القابل للذوبان فصل تخزين مرض Z متحولة.


        ما هي أعراض اضطراب طيف التوحد؟

        يمكن أن يظهر نقص ألفا -1 أنتيتريبسين (AATD) كمرض رئوي عند البالغين ويمكن أن يترافق مع أمراض الكبد في جزء صغير من الأطفال المصابين. في البالغين المصابين ، تتمثل الأعراض الأولى لاضطراب التنفس AATD في ضيق التنفس مع النشاط الخفيف ، وانخفاض القدرة على ممارسة الرياضة ، والصفير. تظهر هذه الأعراض عادة بين سن 20 و 40. يمكن أن تشمل العلامات والأعراض الأخرى التهابات الجهاز التنفسي المتكررة ، والتعب ، وسرعة ضربات القلب عند الوقوف ، ومشاكل في الرؤية ، وفقدان الوزن غير المقصود.

        يعاني بعض الأفراد المصابين بـ AATD من أمراض الرئة المتقدمة وانتفاخ الرئة ، حيث تتلف الأكياس الهوائية الصغيرة (الحويصلات الهوائية) في الرئتين. تشمل أعراض انتفاخ الرئة صعوبة في التنفس وسعال حاد وصدر على شكل برميل. يزيد التدخين أو التعرض لدخان التبغ من ظهور الأعراض وتلف الرئتين. تشمل التشخيصات الشائعة الأخرى مرض الانسداد الرئوي المزمن (مرض الانسداد الرئوي المزمن) والربو والتهاب الشعب الهوائية المزمن وتوسع القصبات - وهي حالة التهابية أو تنكسية مزمنة في واحد أو أكثر من القصبات أو القصبات.

        مرض الكبد ، الذي يسمى تليف الكبد ، هو عرض آخر من أعراض AATD. يمكن أن يكون موجودًا في بعض الأطفال المصابين ، حوالي 10 بالمائة ، وقد تم الإبلاغ عنه أيضًا في 15 بالمائة من البالغين المصابين بـ AATD. يمكن أن تشمل علامات وأعراض أمراض الكبد في مراحلها المتأخرة تورم البطن وسعال الدم وتورم القدمين أو الساقين واصفرار الجلد وبياض العينين (اليرقان).

        في حالات نادرة ، يمكن أن تسبب AATD حالة جلدية تُعرف باسم التهاب السبلة الشحمية ، والتي تتميز بتصلب الجلد مع وجود كتل أو بقع مؤلمة. يختلف التهاب السبلة الشحمية في شدته ويمكن أن يحدث في أي عمر.

        يمكن أن يظهر نقص ألفا -1 أنتيتريبسين (AATD) كمرض رئوي عند البالغين ويمكن أن يترافق مع أمراض الكبد في جزء صغير من الأطفال المصابين. في البالغين المصابين ، تتمثل الأعراض الأولى لاضطراب التنفس AATD في ضيق التنفس مع النشاط الخفيف ، وانخفاض القدرة على ممارسة الرياضة ، والصفير. تظهر هذه الأعراض عادة بين سن 20 و 40. يمكن أن تشمل العلامات والأعراض الأخرى التهابات الجهاز التنفسي المتكررة ، والتعب ، وسرعة ضربات القلب عند الوقوف ، ومشاكل في الرؤية ، وفقدان الوزن غير المقصود.

        يعاني بعض الأفراد المصابين بـ AATD من مرض رئوي متقدم ولديهم انتفاخ رئوي ، حيث تتلف الأكياس الهوائية الصغيرة (الحويصلات الهوائية) في الرئتين. تشمل أعراض انتفاخ الرئة صعوبة في التنفس وسعال حاد وصدر على شكل برميل. يزيد التدخين أو التعرض لدخان التبغ من ظهور الأعراض وتلف الرئتين. تشمل التشخيصات الشائعة الأخرى مرض الانسداد الرئوي المزمن (مرض الانسداد الرئوي المزمن) والربو والتهاب الشعب الهوائية المزمن وتوسع القصبات - وهي حالة التهابية أو تنكسية مزمنة في واحد أو أكثر من القصبات أو القصبات.

        مرض الكبد ، الذي يسمى تليف الكبد ، هو عرض آخر لاضطراب نقص الانتباه مع فرط النشاط. يمكن أن يكون موجودًا في بعض الأطفال المصابين ، حوالي 10 بالمائة ، وقد تم الإبلاغ عنه أيضًا في 15 بالمائة من البالغين المصابين بـ AATD. يمكن أن تشمل علامات وأعراض أمراض الكبد في مراحلها المتأخرة تورم البطن وسعال الدم وتورم القدمين أو الساقين واصفرار الجلد وبياض العينين (اليرقان).

        في حالات نادرة ، يمكن أن تسبب AATD حالة جلدية تُعرف باسم التهاب السبلة الشحمية ، والتي تتميز بتصلب الجلد مع وجود كتل أو بقع مؤلمة. يختلف التهاب السبلة الشحمية في شدته ويمكن أن يحدث في أي عمر.


        الإنزيمات: المعنى ، الآلية ، التصنيف ، العوامل ، والأهمية

        دعونا نجري دراسة متعمقة للإنزيمات. بعد قراءة هذا المقال سوف تتعرف على: 1. معنى الانزيمات 2. تصنيف الانزيمات 3. آلية عمل الانزيم 4. العوامل المؤثرة في عمل الانزيم 5. خصوصية الانزيم 6. تثبيط الانزيم و 7. الأهمية التشخيصية للإنزيمات.

        معنى الانزيمات:

        الإنزيمات عبارة عن محفز حيوي بروتيني (وحتى أحماض نووية) يغير (يعزز بشكل عام) معدل التفاعل.

        الطاقة المجانية للتنشيط وتأثير الحفز:

        يحدث تفاعل كيميائي مثل الركيزة للمنتج ، عندما يمتلك عدد معين من جزيئات الركيزة في أي لحظة طاقة كافية للوصول إلى حالة نشطة تسمى & # 8220transition state & # 8221 حيث احتمال تكوين أو كسر رابطة كيميائية إلى شكل المنتج مرتفع جدا. & # 8220 طاقة مجانية للتنشيط & # 8221 هي كمية الطاقة المطلوبة لإحضار جميع الجزيئات في جرام واحد من الركيزة عند درجة حرارة معينة إلى حالة الانتقال.

        في وجود محفز ، تتحد الركيزة معها لإنتاج حالة عابرة لها طاقة تنشيط أقل من طاقة الركيزة وحدها. هذا يسرع التفاعل. بمجرد تكوين المنتج ، يكون الإنزيم (المحفز) حراً في الاندماج مع جزيء آخر من الركيزة وتكرار العملية. على الرغم من وجود تغيير في الطاقة الحرة للتنشيط في وجود إنزيم ، فإن التغيير الكلي للطاقة الحرة للتفاعل يظل كما هو سواء تم تحفيز التفاعل بواسطة إنزيم أم لا.

        تصنيف الانزيمات:

        يعتمد تصنيف الإنزيمات على:

        (2) الحضور أو الغياب في وقت معين ،

        (3) تنظيم العمل ،

        (4) مكان العمل و

        (5) أهميتها السريرية.

        1. التصنيف على أساس التفاعل المحفز:

        تنقسم الإنزيمات على نطاق واسع إلى ست مجموعات بناءً على نوع التفاعل المحفز.

        (أ) أوكسيدوروكتازات:

        الإنزيمات التي تسبب تفاعلات الأكسدة والاختزال.

        السابق. بيروفات + NADH - نازعة هيدروجين اللاكتات → لاكتات + NAD +

        حمض الجلوتاميك + NAD- نازعة هيدروجين الجلوتامات → α-كيتوجلوتارات + NH3 + NADH

        الإنزيمات التي تحفز نقل المجموعات من ركيزة إلى أخرى غير الهيدروجين. السابق. يحفز Transaminase نقل المجموعة الأمينية من الأحماض الأمينية إلى حمض الكيتو لتكوين حمض كيتو جديد وحمض أميني جديد.

        السابق. (α-Ketoglutarate + Alanine - alanine aminotransferase → Glutamate + Pyruvate

        أسبارتات + ألفا كيتوجلوتارات - أسبارتات أمينوترانسفيراز أوكسالو أسيتات + غلوتامات

        تلك الإنزيمات التي تحفز تكسير الروابط مع إضافة الماء (التحلل المائي). جميع إنزيمات الجهاز الهضمي هي هيدرولاز. السابق. البيبسين ، التربسين ، الأميليز ، المالتاز.

        تلك الإنزيمات التي تحفز تكسير المركب إلى مادتين بآلية أخرى غير إضافة الماء. المنتج الناتج دائمًا ما يكون له رابطة مزدوجة.

        السابق. الفركتوز -1-6-ثنائي الفوسفات- ALDOLASE → Glyceraldehyde-3-phosphate + DHAP

        تلك الإنزيمات التي تحفز التحويل البيني للأيزومرات البصرية والهندسية.

        السابق. جليسيرالديهيد -3 فوسفات- إيزوميراز → فوسفات ثنائي هيدروكسي أسيتون

        تحفز هذه الإنزيمات اتحاد مركبين. هذه دائمًا عملية تتطلب طاقة (عملية نشطة).

        السابق. بيروفات + كو2 + ATP— بيروفات كربوكسيلاز أوكسالوسيتات + ADP + Pi

        2. التصنيف على أساس الحضور أو الغياب في وقت معين:

        يتم تحديد نوعين:

        (أ) الإنزيمات المحفزة:

        تلك الإنزيمات التي تصنعها الخلية كلما دعت الحاجة إليها. يتطلب تركيب هذه الإنزيمات عادة محفزًا.

        السابق. Invertase و HMG-CoA reductase و p-galactosidase والإنزيمات المشاركة في دورة اليوريا.

        (ب) الإنزيمات التأسيسية:

        الإنزيمات الموجودة باستمرار بكميات طبيعية في الجسم ، بغض النظر عن المحرضات.

        3. التصنيف على أساس تنظيم عمل الإنزيم:

        هم من نوعين:

        (أ) الإنزيمات التنظيمية:

        يتم تنظيم عمل هذه الإنزيمات اعتمادًا على حالة الخلية. يتم زيادة أو تقليل عمل الإنزيمات التنظيمية بواسطة مُعدِّل في موقع آخر غير الموقع النشط المسمى & # 8220allosteric site & # 8221.

        السابق. فسفوفركتوكيناز (PFK) وغلوتامات ديهيدروجينيز.

        (ب) الانزيمات غير المنظمة:

        لا يتم تنظيم عمل هذه الإنزيمات.

        السابق. نازعة هيدروجين السكسينات.

        4. التصنيف على أساس مكان العمل:

        اعتمادًا على موقعي العمل ، يتم تقسيمهم إلى -

        (أ) الإنزيمات داخل الخلايا:

        تُعرف الإنزيمات التي تنتجها الخلية وتعمل داخل نفس الخلية باسم الإنزيمات داخل الخلايا.

        السابق. جميع إنزيمات تحلل السكر ودورة TCA.

        (ب) الإنزيمات خارج الخلية:

        إنزيمات تنتجها خلية ولكنها تعمل خارج تلك الخلية بشكل مستقل عنها. على سبيل المثال ، جميع الإنزيمات الهضمية. التربسين ، ليباز البنكرياس ، إلخ.

        5. التصنيف على أساس أهميتها السريرية:

        (أ) إنزيمات البلازما الوظيفية:

        الإنزيمات الموجودة في البلازما بتركيز عالٍ إلى حد كبير وهي وظيفية في البلازما بسبب وجود ركائزها وهي البلازما.

        السابق. مصل الليباز ، إنزيمات تخثر الدم.

        (ب) إنزيمات البلازما غير الوظيفية:

        الإنزيمات الموجودة في البلازما بتركيز ضئيل وليس لها وظيفة في البلازما بسبب عدم وجود ركيزة فيها. إن إنزيمات البلازما غير الوظيفية ذات أهمية تشخيصية.

        تمت تسمية الإنزيمات بأربعة أرقام بواسطة لجنة تسمية الإنزيم ، حيث يتم تسمية الإنزيمات بأربعة أرقام

        يشير الرقم الأول إلى التصنيف الرئيسي

        الرقم الثاني يشير إلى التصنيف الفرعي

        يشير الرقم الثالث إلى التصنيف الفرعي

        الرقم الرابع يشير إلى هذا الإنزيم المعين

        السابق. 2.7.3.2 هو أدينوسين ثلاثي فوسفات - كرياتين فسفوتانسفيراز (كرياتين كيناز).

        آلية عمل الانزيم:

        يجب أن يكون الإنزيم (أو البروتين) في شكله الأصلي ليكون نشطًا بيولوجيًا. يحتوي التشكل ثلاثي الأبعاد للإنزيمات على موقع معين حيث ترتبط الركيزة ويتم العمل عليه ، ويسمى هذا الموقع الموقع النشط.

        تم تخصيص الموقع النشط في منطقتين محددتين:

        (1) موقع الربط - حيث ترتبط الركيزة و

        (2) الموقع التحفيزي - حيث يحدث الإنزيم التحفيزي.

        الأحماض الأمينية الموجودة في الموقع النشط هي التيروزين والهيستيدين والسيستين وحمض الجلوتاميك وحمض الأسبارتيك والليسين والسيرين. في الألدولاز ، يوجد اللايسين في الموقع النشط. في carboxypeptidase ، يوجد اثنان من بقايا التيروزين في الموقع النشط. يحتوي الريبونوكلياز على نوعين من الهيستدين في الموقع النشط. أسس ميكايليس ومينتن نظرية الجمع بين الإنزيم والركيزة لتشكيل مركب الركيزة الإنزيمية. وفقًا لهذا ، يتحد الإنزيم مع الركيزة التي يعمل عليها لتشكيل مركب ركيزة إنزيم. بعد ذلك ، يتم تحرير هذا الإنزيم وتكسير الركيزة إلى ناتج التفاعل.

        E [إنزيم] + S [الركيزة] → ES [مركب الركيزة الإنزيمية] → E + المنتج

        يُطلق على مجمع ES أيضًا اسم & # 8216Michaelis Menten complex & # 8217.

        تعمل الإنزيمات على تسريع معدل التفاعل الكيميائي بأربع آليات رئيسية.

        1. القرب والتوجيه:

        يرتبط الإنزيم بالركيزة بطريقة تجعل الرابطة الحساسة قريبة جدًا من المجموعة الحفازة وأيضًا موجهة إليها بدقة مما يؤدي إلى التحفيز.

        2. الإجهاد والتشويه أو نموذج الملاءمة المستحث:

        يؤدي ارتباط الركيزة إلى إحداث تغيير في التركيب في جزيء الإنزيم الذي يجهد شكل الموقع النشط ويشوه أيضًا الركيزة المحددة ، وبالتالي يؤدي إلى التحفيز. سيؤدي ارتباط الركيزة إلى الإنزيم إلى إحداث تغيير في البنية الثلاثية أو الرباعية لجزيء الإنزيم ، مما يؤدي إلى زعزعة استقرار الإنزيم. من أجل تحقيق الاستقرار ، يقوم الإنزيم بتشويه الركيزة وبالتالي تكوين منتج التفاعل.

        3. الحفز العام الحمضي القاعدي:

        يحتوي الموقع النشط للإنزيم على أحماض أمينية تعتبر مانحة جيدة للبروتون أو متقبلات للبروتون ، وهذا يؤدي إلى تحفيز القاعدة الحمضية للركيزة.

        4. الحفز التساهمي:

        تتفاعل بعض الإنزيمات مع ركائزها لتشكيل مجمعات ركيزة إنزيمية مرتبطة تساهميًا للغاية ، والتي تخضع لمزيد من التفاعل لتشكيل المنتجات.

        العوامل المؤثرة في عمل الإنزيم:

        العوامل التي تؤثر على معدل تفاعل الإنزيم المحفز هي:

        3. تركيز الركيزة

        5. تركيز المنتجات

        1. تأثير درجة الحرارة:

        عندما تظل جميع المعلمات الأخرى ثابتة (أي عند مستواها الأمثل) ، فإن معدل تفاعل الإنزيم يزداد ببطء مع زيادة درجة الحرارة حتى يصل إلى الحد الأقصى. تؤدي الزيادة الإضافية في درجة الحرارة إلى تغيير طبيعة البروتين مما يؤدي إلى انخفاض في عمل الإنزيم وزيادة أخرى في درجة الحرارة قد يؤدي إلى تدمير البروتين تمامًا.

        يُطلق على درجة الحرارة ، التي يكون عندها نشاط الإنزيم الحد الأقصى ، درجة الحرارة المثلى. تكون معظم الإنزيمات غير نشطة تمامًا عند 0 درجة مئوية إلى 4 درجات مئوية ، ويبدأ نشاطها عند 10 درجات مئوية ويزداد ببطء لتصل إلى أقصى سعتها عند درجة الحرارة المثلى. غالبية الإنزيمات في جسم الإنسان لها درجات حرارة مثلى بين 37 درجة مئوية و 40 درجة مئوية.

        بعد درجة الحرارة هذه ، تصبح الإنزيمات أقل نشاطًا وقد تفقد نشاطها تمامًا في درجات الحرارة المرتفعة. في الحمى ، يؤدي ارتفاع درجة الحرارة إلى زيادة نشاط التمثيل الغذائي بسبب زيادة التأثير الأنزيمي. يؤدي انخفاض درجة الحرارة إلى انخفاض حرارة الجسم وهو ما يظهر في عمليات زراعة الأعضاء وجراحة القلب المفتوح.

        ومع ذلك ، توجد الحياة في مناطق شديدة البرودة وأيضًا في الينابيع الساخنة ، مما يشير إلى أن نفس الإنزيم الموجود في الخلية البشرية ، على سبيل المثال إنزيمات تحلل السكر ودورة TCA لها درجات حرارة مثالية عند درجات الحرارة القصوى.

        وبالتالي توجد بكتيريا التبريد مع درجة حرارة مثالية لإنزيماتها تقترب من 4 درجات مئوية. وبالمثل ، تمتلك البكتيريا التي تعيش في الينابيع الساخنة الإنزيمات مع درجات حرارة مثالية تقترب من مائة درجة مئوية. درجة الحرارة المثلى لـ Taq polymerase هي 72 درجة مئوية.

        معامل فانت هوفس:

        إنه المعامل الذي يفسر أنه لكل ارتفاع في درجة الحرارة بمقدار 10 درجات مئوية ، يزداد نشاط الإنزيم مرتين حتى الوصول إلى درجة الحرارة المثلى.

        2. تأثير الأس الهيدروجيني:

        عندما تظل جميع المعلمات الأخرى ثابتة ، تزداد سرعة تفاعل تحفيز الإنزيم حتى تصل إلى الرقم الهيدروجيني الأمثل ثم تنخفض مع زيادة / نقصان في الرقم الهيدروجيني. النشاط هو الحد الأقصى لمعظم الإنزيمات عند درجة الحموضة البيولوجية 7.4. يكون الرقم الهيدروجيني الأمثل للبيبسين 1.5 ، والفوسفاتيز الحمضي 4.5 ، والفوسفاتيز القلوي 9.8.

        3. تأثير تركيز الركيزة:

        عندما تظل جميع المعلمات الأخرى ثابتة بما في ذلك تركيز الإنزيم ، فعند زيادة تركيز الركيزة ، يزداد معدل التفاعل بشكل مطرد ، حتى يتشبع الإنزيم بالركيزة. في هذه المرحلة ، لا يزيد معدل التفاعل ويظل ثابتًا. عندما يتم رسم الرسم البياني بالسرعة مقابل تركيز الركيزة فإنه يعطي منحنى قطعي.

        هذا لأنه ، مع زيادة تركيز الركيزة ، تتحد جزيئات الركيزة مع جميع جزيئات الإنزيم المتاحة في مواقعها النشطة حتى لا تتوفر مواقع أكثر نشاطًا. وبالتالي في هذه المرحلة ، تقوم الركيزة بتجديد المواقع فقط عندما يتم تحرير المنتجات ولا يمكنها زيادة معدل التفاعل.

        كم يُعرَّف بأنه تركيز الركيزة حيث تكون سرعة تفاعل الإنزيم المحفز نصف السرعة القصوى.

        أنا. ارتفاع Kم تشير القيمة إلى ارتباط ضعيف بين الإنزيم والركيزة.

        ثانيا. منخفض كم يشير إلى ارتباط قوي.

        حدود معادلة Michaelis-Menten:

        أنا. تتيح هذه المعادلة حساب القيمة التقريبية للسرعة القصوى وليس القيمة الدقيقة.

        ثانيا. إنه مناسب للإنزيمات التي لها موقع نشط فقط وليس موقع خيفي.

        ثالثا. يحسب K.م للتفاعلات أحادية الركيزة وليس للتفاعلات متعددة الركائز.

        رابعا. يتم استخدامه لمعرفة سرعة الإنزيمات غير التنظيمية ولكن ليس الإنزيمات المنظمة.

        من أجل التغلب على القيود المذكورة أعلاه ، يتم رسم مؤامرة Line Weaver-Burke من أجل إقامة علاقة بين التبادلات لتركيز الركيزة والسرعة.

        مؤامرة الخط ويفر بورك:

        نقلب معادلة ميكايليس-مينتين ، نحصل عليه

        من خلال هذه المعادلة يمكننا الحساب بدقة:

        أنا. سرعة أي تفاعل محفز بالإنزيم.

        ثانيا. معدل التفاعل عند وجود أكثر من ركيزة واحدة.

        ثالثا. سرعة جميع الانزيمات.

        تعطي الإنزيمات التنظيمية منحنىًا سينيًا وتعطي الإنزيمات غير التنظيمية منحنى قطعي.

        4. تأثير تركيز الانزيم:

        مع زيادة تركيز الإنزيم ، يزداد معدل التفاعل بشكل مطرد في وجود كمية زائدة من الركيزة ، ويتم الحفاظ على العوامل الأخرى ثابتة. يتم إنتاج منحنى خطي.

        5. تأثير المنتجات:

        عندما يكون المنتج أكثر في خليط التفاعل ، ينخفض ​​معدل التفاعل بسبب تثبيط التغذية المرتدة.

        6. تأثير الضوء:

        تتغير سرعة نشاط الإنزيمات المختلفة في الطول الموجي المختلف للضوء على سبيل المثال. يعزز الضوء الأزرق من نشاط الأميليز اللعابي ، في حين أن الأشعة فوق البنفسجية. يقلل الضوء من السرعة.

        7. تأثير الأيونات:

        إن وجود أو عدم وجود أيونات معينة يعزز أو يقلل من نشاط الإنزيمات السابقة. يتم تحويل البيبسينوجين إلى الببسين في وجود أيونات H +. تعمل كينازات في وجود أيونات Mg +2.

        خصوصية الانزيم:

        الإنزيمات محددة جدًا في تفاعلها. إما أنها تعمل على ركيزة معينة أو تحفز تفاعل واحد معين.

        وفقًا لذلك ، تكون خصوصية الإنزيم من نوعين:

        1. خصوصية رد الفعل:

        هذه الإنزيمات محددة لنوع التفاعل الذي تحفزه ، بغض النظر عن الركيزة التي تعمل عليها. وبالتالي تؤدي الإنزيمات المختلفة إلى تفاعلات مختلفة على نفس الركيزة ، أي أن الإنزيمات محددة لتفاعل معين واحد بغض النظر عن الركيزة التي قد تكون موجودة. تعمل الأحماض الأمينية عن طريق أوكسيديز الأحماض الأمينية الذي يؤكسد الأحماض الأمينية إلى أحماض كيتو ونزع الكربوكسيل الذي يزيل ثاني أكسيد الكربون منها.

        2. خصوصية الركيزة:

        هذه الإنزيمات خاصة بالركيزة التي تعمل عليها. هذا مصنف كذلك على النحو التالي.

        (أ) الخصوصية المطلقة:

        هذه الإنزيمات محددة للغاية وتعمل على ركيزة معينة فقط ولا توجد ركيزة أخرى. السابق. يورياس ، كاتلاز ، أسبارتاز.

        (ب) الخصوصية النسبية:

        تعمل هذه الإنزيمات على رابطة معينة واحدة. السابق. أوكسيديز حمض أميني د.

        (ج) خصوصية المجموعة:

        تعمل هذه الإنزيمات على مجموعة معينة واحدة فقط.

        هو إنزيم محلل للبروتين يعمل على روابط الببتيد التي تساهم بها الأحماض الأمينية العطرية مثل التيروزين والتريبتوفان والفينيل ألانين.

        خاص بالأحماض الأمينية الأساسية. ومن ثم فإنه يشق روابط الببتيد التي يساهم بها ليسين وأرجينين.

        يعمل على رابطة الببتيد بالقرب من النهاية الأمينية الحرة.

        محدد لمجموعة الكربوكسيل المجانية.

        خاص بـ α-1 → 4 روابط جليكوسيدية.

        (د) خصوصية ستيريو:

        تعمل هذه الإنزيمات على أيزومر استريو معين.

        أنا. نازعة هيدروجين سكسينات:

        خاص بإيزومر ستريو فومارات أي شكل رابطة الدول المستقلة من الرابطة المزدوجة.

        خاص بالارتباط β الجليكوسيد.

        ثالثا. أكسيدات الأحماض الأمينية:

        يعمل على الأحماض الأمينية L فقط وليس على الأحماض الأمينية D.

        وهي مركبات عضوية غير بروتينية ومستقرة للحرارة وذات وزن جزيئي منخفض قابلة للتحليل وهي ضرورية لعمل الإنزيمات. تعمل الفيتامينات بشكل عام كأنزيمات مساعدة سابقة. البيوتين ، البيريدوكسين ، إلخ. الإنزيم مع الإنزيم المساعد يُعرف بـ & # 8216holoenzyme & # 8217 وأنه بدون إنزيم مساعد & # 8216apoenzyme & # 8217. Apoenzyme (بروتين) + Co-enzyme (غير بروتين) → Holoenzyme (بروتين إنزيم نشط).

        قد يحتوي Holoenzyme على مركب عضوي أو غير عضوي (أيونات معدنية) أو كليهما. إذا كانت المواد العضوية موجودة مع الإنزيمات ، فإنها تُعرف باسم & # 8216-co-enzymes & # 8217 وإذا كانت المواد غير العضوية تعمل مع الإنزيمات ، فيتم تسميتها بـ & # 8216co-factor & # 8217 (Mg، Mn، Zn، Co، Se ، إلخ.).

        دور الإنزيمات المساعدة هو:

        (ط) أنها بمثابة الركيزة المشتركة أو الركيزة الثانية السابقين. بيروفات + NADH - لاكتات + NAD +. يعمل NADH بمثابة أنزيم أو ركيزة ثانية ،

        (2) أنها تساعد في نقل المجموعات إما الهيدروجين أو مجموعات أخرى غير الهيدروجين ، و

        (3) النشاط المحدد للإنزيم المساعد هو عدد وحدات الإنزيم المشترك الموجود في مليغرام واحد من بروتين الإنزيم.

        وحدة أو نشاط الإنزيم:

        وحدة واحدة من نشاط الإنزيم هي كمية الإنزيم التي تحول 1.0 (JM من الركيزة في الدقيقة إلى المنتجات عند 25 درجة مئوية.

        نشاط محدد للإنزيم:

        يتم تعريفه على أنه عدد وحدات الإنزيم لكل مليغرام من البروتين.

        رقم دوران الإنزيم:

        يُعرف عدد جزيئات الركيزة التي يتم تحويلها في الدقيقة (وحدة الوقت) بواسطة إنزيم واحد باسم رقم دوران الإنزيم. يحتوي الأنهيدراز الكربوني على أعلى رقم دوران يبلغ 36.000.000.

        رد الفعل من الدرجة الأولى والثانية:

        يُطلق على التفاعل الذي يوجد فيه ركيزة واحدة فقط رد فعل من الدرجة الأولى. يُطلق على التفاعل الذي تشارك فيه ركيزتان لتشكيل منتج رد فعل من الدرجة الثانية ، يُعرف أيضًا باسم تفاعل الركيزة الثنائية. يتضمن هذا إما إزاحة مفردة (أي أن كلا الركيزتين المرتبطين بموقعين نشطين في الإنزيم في نفس الوقت) أو إزاحة مزدوجة (إزاحة بينج بونج ، حيث ترتبط ركيزة واحدة فقط بموقع الإنزيم النشط في وقت معين ، بمجرد إطلاق هذا الركيزة الأخرى تربط).

        يُعرف الشكل غير النشط من الإنزيم باسم zymogen أو pro-enzyme. البيبسينوجين والتريبسينوجين هما من مركبات البيبسين والتربسين على التوالي.

        تُعرف الأحماض النووية الريبونية التي تحفز تفاعلًا مشابهًا لتفاعل الإنزيمات باسم الريبوزيمات. تساعد هذه الريبوزيمات في معالجة الحمض النووي الريبي السابق المنسوخ حديثًا. الحمض النووي الريبي النووي الصغير (SnRNA) والرنا النووي المغاير (hnRNA).

        تثبيط الانزيم:

        يسمى التغيير في نشاط الإنزيم بمواد معينة بخلاف المواد غير المحددة مثل الأس الهيدروجيني ودرجة الحرارة وما إلى ذلك تثبيط الإنزيم.

        هناك نوعان من مثبطات الإنزيم:

        1. تثبيط إنزيم لا رجوع فيه:

        يتم تثبيط نشاط الإنزيم عن طريق الارتباط التساهمي للمثبط في الموقع النشط. لا يمكن فصل رابطة مثبط الإنزيم ، لذا فهي دائمة ولا رجوع عنها أي لا يمكن عكسها.

        أنا. يتم تثبيط Aldolase بشكل دائم بواسطة iodoacetate.

        ثانيا. ثنائي إيزوبروبيل فلوروفوسفات (DFP) ، أحد مكونات غاز الأعصاب ، يثبط معظم الإنزيمات الهضمية بشكل دائم في البشر. ومن ثم فهي شديدة السمية.

        ثالثا. بنزوات كلورومركوريك بارا (PCMB) يثبط إنزيمات هكسوكيناز واليورياز بشكل لا رجعة فيه.

        رابعا. الكواشف العضوية مثل الكواشف القلوية تمنع الإنزيمات بشكل لا رجعة فيه.

        2. تثبيط إنزيم عكسي:

        ترتبط المثبطات بالإنزيم بشكل عكسي وبالتالي فهو ليس دائمًا. يمكن عكس التثبيط من خلال آليات مختلفة.

        (أ) تثبيط الإنزيم التنافسي:

        إنه نوع من التثبيط القابل للانعكاس حيث توجد منافسة بين الركيزة والمثبط للموقع النشط للإنزيم بسبب التشابه الهيكلي. تظهر جميع الإنزيمات غير التنظيمية تثبيطًا تنافسيًا. Clinically competitive enzyme inhibition is of great importance since most of the drugs act by competitive inhibition.

        (i) The enzyme succinate dehydrogenase’s (SDH) substrate is succinic acid and the competitive inhibitors are oxalic acid, mallonic acid and glutaric acid. Among these, mallonic acid is the most potent competitive inhibitor of SDH.

        (ii) Folic acid, a vitamin for human beings has para-amino benzoic acid (PABA) as one of its components. Whereas it is not a vitamin for microorganisms i.e., they cannot utilize preformed folic acid from external source, instead they synthesize their own folic acid from aba. Sulpha drugs contain para-amino sulphonate which is structurally similar to PABA and hence competes for the enzyme active site of folic acid synthesis in microorganisms. If excess dose of sulpha drug is given, it results in inhibition of folic acid synthesis thus acting as an antibiotic. Human beings are not affected, because they do not synthesize folic acid.

        (iii) Methanol is acted upon by the enzyme alcohol dehydrogenase forming formaldehyde which is highly poisonous. If ethanol if given to methanol intoxicated patients then ethanol competitively binds to alcohol dehydrogenase thereby preventing formation of formaldehyde.

        (iv) Allopurinol is the competitive inhibitor of the enzyme xanthine oxidase whose substrate is hypoxanthine. Allopurinol prevents the formation of uric acid by competitive inhibition because it has structural similarity to hypoxanthine. This principle is used in the treatment of gout i.e. abnormal accumulation of uric acid crystals in the joint causing inflammation.

        (v) Glaucoma is a condition in which there is accumulation of fluid in the lens resulting in enlargement of eye. This can be treated with ‘acetazolamide’ which inhibits the enzyme carbonic anhydrase competitively. This prevents water formation and subsequent release of more water through the urine.

        (b) Non-competitive enzyme inhibition:

        It is shown by regulatory enzymes, also called allosteric enzymes.

        These are the enzymes that contain a site other than the active site which is called ‘allosteric site’. The action of some enzymes is regulated by ‘effectors’ which can bind reversibly to the enzyme molecule at specific sites other than the substrate binding site called the modulator site or the allosteric site.

        There is no competition between substrate and inhibitor for the active site since the inhibitor or modulator binds at the modulator site or allosteric site. If the binding of the effector causes inhibition of the enzyme action then it is called a negative effector and the process is called ‘allosteric inhibition’.

        If the enzyme reaction is activated by a modulator then it is called a positive modulator or effector and the process is called ‘allosteric activation’.

        السابق. Phosphofructo kinase (PFK) is an allosteric enzyme of the glycolytic pathway.

        The positive modulators of this enzyme are AMP and ADP.

        The negative modulators of PFK are ATP and citrate.

        These are substances (generally proteinacious in nature) that inhibit most of the digestive enzymes, ex. certain roundworms and hookworms survive in the intestine by secreting anti enzymes. Uncooked rice contains certain proteins that act as anti enzymes.

        Reversible covalent modification:

        Enzyme activity can be regulated by reversible covalent modification.

        It is regulated by cyclic inter-conversion of enzyme into two forms:

        The inter-conversion is brought about by a ‘converting enzyme’. The process of activation and inactivation of the enzyme is generally brought about by covalent phosphorylation or de-phosphorylation of the target enzyme. For example hormones like epinephrine, glucagon etc. bind to the hormone receptor site on the cell membrane and activate the enzyme adenyl cyclase, which in turn converts ATP to cyclic AMP (cAMP). This cAMP converts inactive protein kinase to active protein kinase (‘a’ form). This protein kinase phosphorylates many enzymes in the cell, some of which become active and yet some others become inactive.

        The inactive phosphorylase (‘b’ form) gets converted to active phosphorylase (‘a’ form) upon phosphorylation and affects the breakdown of glycogen to glucose. On the other hand glycogen synthase becomes inactive upon phosphorylation thereby inhibiting the formation of glycogen.

        Diagnostic Importance of Enzymes:

        Enzymes were classified into two groups based upon their clinical importance as ‘functional plasma enzymes’ i.e., those enzymes present in the plasma in considerably high amounts and are functional in the plasma due to the presence of their substrate in it.

        السابق. serum lipase, blood clotting enzymes, and ‘non-­functional plasma enzymes’ i.e., those enzymes that are present in the plasma in negligible amounts and have no function in the plasma due to the absence of their substrate in it. Non-functional plasma enzymes are of diagnostic importance.

        The non-functional plasma enzymes are present in higher concentration in tissues and very low concentration in the plasma i.e. in trace amounts, but their concentration in plasma increases immediately following tissue injury or destruction.

        If there is tissue damage leading to cell rupture then the enzymes present in that tissue leaks into the blood leading to the increase in the concentration of these enzymes in the plasma. Increase in the level of non-functional plasma enzymes in the blood, indicates the disorder to the tissue where they exist. Different enzymes exist in different tissues in varying levels. Damage to a specific tissue releases a particular enzyme. Therefore estimation of enzymes in the plasma has a diagnostic importance.

        The non-functional plasma enzymes include lactate dehydrogenase (LDH), creatine phosphokinase (CPK), alanine amino transferase (ALT) or serum glutamate pyruvate transaminase (SGPT), aspartate transaminase (AST) or serum glutamate oxaloacetate transaminase (SGOT), sorbitol dehydrogenase, alkaline phosphatase, acid phosphatase, amylase, pancreatic lipase etc.

        However functional plasma enzymes are already in higher concentration in the plasma, hence their decrease in the concentration in the plasma indicates malfunction of the organ where they are synthesized ex. blood clotting enzymes are synthesized in the liver hence decrease in their concentration indicates liver dysfunction.

        Anyway an immediate assessment of the liver function cannot be made by this assessment because by the time the enzyme concentration in the plasma decreases (may take 4 to 5 days), the liver must have regained its normal vitality.

        Diagnosis of Myocardial Infarction using Enzyme Assay:

        There are three main enzymes that are used in the diagnosis of myocardial infarction (1) Lactate dehydrogenase (LDH) (2) Creatine phosphokinase (CPK)—marker enzyme and (3) Transaminase (AST or SGOT).

        (1) Lactate dehydrogenase (LDH):

        LDH catalyses the inter conversion of pyruvate to lactate, a very important reaction of anaerobic glycolysis. Glycolysis occurs in each and every cell, in some cells it is always anaerobic (RBC) whereas in others it is aerobic sometimes and anaerobic at some other time (muscle tissue, liver, kidney etc.).

        In other words LDH is present in each and every cell of the body. Therefore damage to any of the tissues of the body results in release of LDH into the plasma. Hence it becomes a difficult task to trace out the organ from which it has leaked.

        However LDH exists in five isoenzyme forms i.e. multiple forms of the same enzyme (These enzymes bring about the same reaction but exhibit different physical characters like molecular weight, charge, electrophoretic mobility, Kم and isoelectric pH). The polypeptides in LDH are designated as ‘H chain’ and ‘M chain’.

        All the isoenzyme forms of LDH are tetramer i.e. has four polypeptides in the following combinations:

        (e) M4 or LDH5—Liver and skeletal muscle

        All these isomers have been successfully separated on Sodium Dodecyl Sulphate Polyacryl Amide Gel Electrophoresis (SDS-PAGE) and their banding pattern from the plasma is established as under—

        LDH1 أو H.4 is predominantly present in the cardiac muscle, whereas the isoenzyme form LDH5 or M4 is more abundant in the skeletal muscle. These two enzymes have different Km values and Km is indirectly proportional to affinity (Kم a 1/affinity).

        The skeletal muscle enzyme M4 has low Kم value for pyruvate and hence greater affinity for pyruvate resulting in high rate of conversion of pyruvate to lactate. The cardiac isoenzyme LDH1 أو H.4 has high Kم value for pyruvate hence lesser affinity for pyruvate, therefore low rate of conversion of pyruvate to lactate. Thus the concentration of H4 or LDH1 isoenzyme form of lactate dehydrogenase increases in the plasma during myocardial infarction. The peak levels of LDH are maintained in the plasma for 6 days following the attack, after which it starts receding in its concentration.

        (2) Creatine phosphokinase (CPK):

        This is known as the marker enzyme for the diagnosis of myocardial infarction or heart attack, because this is the first enzyme to increase within a short time in the blood plasma following a heart attack. CPK is an enzyme that catalyses the conversion of creatine to creatine phosphate, a high energy compound that works to supply energy during muscle contraction. Therefore this enzyme is present only in a few tissues like the cardiac muscle, skeletal muscle and the brain.

        CPK also exists in various isoenzyme forms. It has two polypeptides ‘B’ & ‘M’ that form dimers in the following combinations to give rise to three isoenzymes of CPK.

        MB — Predominant in cardiac muscle

        MM — Predominant in skeletal muscle

        Thus estimation of the isoenzyme MB is indicative of heart attack. CPK maintains a higher concentration in the plasma for 1-2 days. The concentration of CPK after the first attack is 10 times more than the normal and if another attack occurs within a day or two the concentration further increases to 100 fold and a third attack within a short span of time raises the level of CPK to 300 fold which is lethal concentration.

        Among the two transaminases, aspartyl transaminase (AST or SGOT) increases in the plasma following an attack and the higher levels are seen in 4 to 5 days following an attack.


        Z and S Mutations of the 㬑-Antitrypsin Gene and the Risk of Chronic Obstructive Pulmonary Disease

        Chronic obstructive pulmonary disease (COPD) has been associated with heterozygosity for the Z and S alleles of the α1-antitrypsin gene in some studies, but these observations have not been confirmed by others. Cigarette smoking is the major risk factor for COPD and may have been a confounding factor in many of the previous studies. We investigated whether the Z or S alleles were more prevalent in a group of heavy smokers with COPD than in a group of nonobstructed smokers. Forced expiratory volume in 1 s and forced vital capacity were derived for 266 patients undergoing lobar or lung resection. These lung-function measurements were used to divide the patients into a COPD group and a group of nonobstructed control subjects. The subjects were typed for the Z and S alleles of the α1-antitrypsin gene using a polymerase chain reaction–based technique. In the COPD patients, 12 of 193 (6%) were heterozygous for the Z allele (MZ) compared with 0 of 73 control subjects, which gave a ص value of 0.04 after correction for age, gender, and smoking history. There was no association of the S allele with COPD. The results indicate that the Z, but not the S, allele is a risk factor for COPD in the heterozygous state.

        Chronic obstructive pulmonary disease (COPD) is characterized by decreased expiratory flow rates, increased pulmonary resistance, and hyperinflation. The processes that underlie these symptoms are thought to be proteolytic destruction of the lung parenchyma and inflammatory narrowing of the peripheral airways.

        The association between very low serum concentrations of α1-antitrypsin and pulmonary emphysema was originally described by Laurell and Eriksson (1). α1-Antitrypsin is a serine protease inhibitor (Pi) that primarily binds neutrophil elastase and therefore prevents the breakdown of elastic tissue, mainly in the lung. More than 70 different biochemical variants, or Pi types, have been described (2). The most common variant, M, consists of at least six subtypes, all characterized by normal serum α1-antitrypsin levels. The Z and S variants are associated with α1-antitrypsin deficiency. The population prevalences for the MM, MS, and MZ genotypes among whites are 86, 9, and 3%, respectively (3). MM individuals have normal levels of α1-antitrypsin, whereas MS and MZ individuals have mean levels of 75% and 57% of normal, respectively. Individuals with the ZZ genotype have severe α1-antitrypsin deficiency, with mean levels at ∼ 15% of normal, and are at increased risk for COPD (4). Homozygosity for the S allele results in a mean α1-antitrypsin level ∼ 52% of normal and occurs in ∼ 0.1% of whites (5, 6). Individuals with the SS genotype may have an increased risk for emphysema (7, 8). SZ compound heterozygotes are also at risk for COPD (9).

        The issue of whether the Z and S alleles are risk factors for COPD in the heterozygous state remains controversial. Several case–control studies have found a higher prevalence of MZ heterozygotes among COPD patients than in control populations (7, 8, 10-15). However, comparisons of MZ individuals with MM subjects from the general population have generally found no excess risk of COPD (or decline in respiratory function) associated with MZ heterozygosity (16-23).

        We have investigated the prevalence of α1-antitrypsin genotypes in a group of heavy cigarette smokers with and without airway obstruction. The subjects for both groups were selected on the basis of their development of bronchogenic cancer, which resulted in a study population with a high level of exposure to cigarette smoke. Therefore, the COPD patients could be compared with individuals who had maintained normal airway function despite being chronic heavy smokers. Measurements of lung elastic recoil (maximal static recoil pressure [P l الأعلى]) and emphysema were available for the majority of subjects. Therefore, we were able to investigate whether the Z allele was associated with emphysema and loss of elastic recoil, as suggested by previous studies (24). By employing a polymerase chain reaction (PCR) method to genotype the samples, we were able to include individuals in the study for whom only paraffin-embedded tissue samples were available.

        Subjects for the study were recruited from 532 patients undergoing lobar or lung resection. Before surgery, the patients completed an interviewer-administered questionnaire regarding smoking history, occupational exposure to dusts or fumes, and respiratory symptoms. Lung-function measurements made on each patient included subdivisions of lung volume measured in a pressure-compensated body plethysmograph, and maximal expiratory flow and volume. Values of forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), and the FEV1/FVC ratio were calculated. In 63% of the subjects a pressure volume curve of the lung was also obtained, from which the P l الأعلى was derived as previously described (25). In 68% of the subjects, resected lung samples were graded for emphysema as previously described (26).

        Any patients in whom the lung lesion was obstructing a segmental or larger bronchus, or in whom there was evidence of significant obstructive pneumonitis, were not included in the study because these conditions may influence lung function. There were 28 nonsmokers who were excluded from the study groups.

        On the basis of the lung function tests, the remaining 504 patients were divided into those with and without significant airway obstruction. Obstructed patients were those who had an FEV1 < 80% predicted and an FEV1/ FVC < 70%. Nonobstructed patients were those who had an FEV1 > 85% predicted and an FEV1/FVC > 75%. There were 219 patients classified as obstructed, and 73 as nonobstructed. All of the patients were of white ancestry. We were able to extract and amplify DNA successfully from 266 of these subjects, including 193 obstructed and 73 nonobstructed patients. In this population the mean age was 63 ± 10 yr, and mean cigarette smoking was 55 ± 33 pack-yr. The 212 subjects with intermediate levels of lung function were not used in the study.

        Genomic DNA was extracted from frozen lung-tissue samples, peripheral blood leukocytes (27), or paraffin-embedded tissue samples (28) by standard techniques.

        Detection of the Pi Z allele was performed by a modification of the PCR method described by Dry (29). For PCR amplification of the region of exon V containing the Z mutation, the following oligonucleotide primers were used: 5′TAAGGCTGTGCTGACCATCGTC3′ and 5′CAAAGGGTTTGTTGAACTTGACC3′.

        PCR was carried out in a 20-μl volume containing 100 ng genomic DNA 1 μM of each primer 200 μM each of dGTP, dCTP, dTTP, and dATP 1.5 mM MgCl2 and 0.5 U طق DNA polymerase. Amplification conditions were 40 cycles of 94°C for 30 s, 59°C for 30 s, and 72°C for 10 s. Samples were then digested at 65°C with 10 U of طقI restriction enzyme, and electrophoresed on 3% agarose gels stained with ethidium bromide. The amplification produced a 110-base pair (bp) product and introduced a طقI restriction site into the wild-type M allele but not into the Z allele. Therefore, after طقI digestion, the M allele was cut into 89- and 21-bp bands, whereas the Z allele remained as a 110-bp band (Figure 1 ).

        Fig. 1. Analysis of the α1-antitrypsin Z and S mutations using restriction endonuclease digestion. (أ) طقI digestion of PCR products amplified from exon V yields an 89-bp fragment from the M allele and a 110-bp fragment from the Z allele. (ب) طقI digestion of PCR products amplified from exon III yields a 98-bp fragment from the M allele and a 78-bp fragment from the S allele. L = 100-bp DNA ladder.

        Analysis of the S allele in exon III was performed by a similar method. Primers were designed so that the upstream primer introduced an artificial طقI restriction site in the M allele but not in the S allele. Primers for this analysis were 5′GAGGGGAAACTACAGCACCTCG3′ and 5′ACCCTCAGGTTGGGGAATCACC3′. The PCR was carried out using the same conditions as the Z mutation. The amplification produced a 98-bp product that was subsequently digested with 10 U of طقI. The M allele sequence contained a طقI restriction site and therefore was cut into 78- and 20-bp bands, but the S allele remained as a 98-bp band (Figure 1 ). Samples of these restriction enzyme analyses were confirmed using sequence-specific oligonucleotide (SSO) probes as described by Bruun-Petersen and colleagues (30).

        The associations of the Z and S mutations with obstruction were tested by the score test from logistic regression. Analyses were adjusted for the effects of age, sex, and smoking. Smoking was examined by cigarette years: the number of years smoked times the number of cigarettes smoked per day.

        The mean physiologic and morphologic data for the two groups are shown in Table 1. Because the obstructed and nonobstructed groups were significantly different for age, sex, and smoking, the results were corrected for these potentially confounding factors by logistic regression.

        Table 1. Population characteristics and pulmonary function values in obstructed versus nonobstructed individuals

        The prevalence of MS heterozygosity in all of the study subjects was 23 of 266 (9%). In addition, 2 of 266 (1%) subjects were found with the SS genotype. The distribution of genotypes was consistent with previous studies of white populations (3). The results are summarized according to phenotype in Table 2. The genotypes of all the MS and SS individuals were confirmed using the SSO method.

        Table 2. Prevalence of S and Z alleles of the α1-antitrypsin gene in obstructed and nonobstructed subjects

        * Adjusted for age, sex, and smoking history.

        In the obstructed group, 16 of 193 subjects (8%) were MS, compared with 7 of 73 (10%) in the nonobstructed subjects. The two SS homozygotes were from the obstructed group. The FEV1 values for these subjects were 71% and 70% predicted, and the FEV1/FVC values were 64% and 61%. The odds ratio associated with the MS/SS genotypes was 0.80 (95% CI = 0.29, 2.18) after correction for age, sex, and smoking history, and was not significant (ص = 0.65).

        Twelve of 266 (4%) of the subjects in the study were heterozygous for the Z allele, and no ZZ individuals were detected. These data were consistent with previous population studies of white individuals (3). The prevalence of the MZ genotype in the obstructed and nonobstructed groups is summarized in Table 2. All of the MZ genotypes were confirmed by SSO typing.

        The Z allele was found in 12 of 193 (6%) of the obstructed group compared with 0 of 73 subjects in the nonobstructed control group. The MZ genotype was associated with airway obstruction after correction for age, sex, and smoking history (ص = 0.04). It was not possible to calculate an odds ratio for this genotype because none of the control group had the mutation. There were no significant differences in mean P l الأعلى % predicted (89% versus 80%, ص = 0.62) or mean emphysema score (14 versus 16, ص = 0.77) in obstructed subjects with the MZ genotype versus obstructed patients with the MM genotype.

        Previous studies of α1-antitrypsin deficiency alleles and the risk of COPD have been of two designs. First, case– control studies were used to compare the prevalence of MZ and MS heterozygotes in groups of COPD patients and in control subjects. The usual finding from these studies was that the presence of the MZ genotype was a significant risk factor for COPD (7, 8, 10-15). The major criticism of these studies has been that the cases and controls were ascertained separately with different recruitment strategies. This may lead to a systematic difference between cases and controls (e.g., in ethnic background) that may bias the results.

        The second type of study designed to detect an effect of S and Z heterozygosity involved selecting samples of individuals with MZ or MS genotypes for comparison with MM individuals. For the most part these population studies have shown no increased risk of impaired lung function with heterozygosity for either allele (16-23). The major problem with these studies is that they have insufficient power to detect a factor that produces a modest increase in risk. In addition, many of the subjects in these studies were not old enough to have developed COPD or were nonsmokers. However, in some population studies MZ individuals were found to have significantly worse lung function (14, 31-35).

        In the present study we used a novel design to improve the power of the case–control approach and decrease the chance of ascertainment bias. By selecting only those individuals who have smoked enough to develop lung cancer we attempted to ensure that both the cases and the controls had a high exposure to the most important risk factor for airway obstruction. However, the obstructed group was older, had smoked more, and had a higher percentage of males than the nonobstructed group. These differences may have accounted for the development of COPD in the obstructed group. Therefore, we adjusted the results of the analyses by logistic regression.

        The genotype frequencies in our study subjects (9% MS, 4% MZ) were similar to those found in general white populations (9% MS, 3% MZ) (3). We did not identify any ZZ homozygotes in our study groups. Previous studies have found that 1 to 3% of COPD patients have the ZZ genotype (8, 11). We may have found fewer ZZ homozygotes than expected because our subjects were recruited from lung cancer patients. It is possible that ZZ individuals would have experienced fatal loss of lung function before they could have smoked enough to develop lung cancer. Alternatively, these individuals may have had early onset COPD with lung function sufficiently impaired to preclude lung resection.

        There was no association of the MZ genotype with emphysema or loss of elastic recoil. However, we cannot rule out such associations because the number of MZ subjects for whom these data were available was small (emphysema score, ن = 7 P l الأعلى, ن = 5). In addition, although patients who have COPD and are homozygous ZZ often have a pure form of emphysema, they may also present with primarily airway disease (36).

        Because all subjects were ascertained in the same way, the risk for a systematic bias in the genotype distribution was minimized. However, we recognize the possibility that an association observed in patients with lung cancer may not be applicable to the general population.

        We devised genotyping protocols that allowed detection of the Z and S alleles by PCR. The products of the amplification were designed to be short DNA fragments of approximately 100 bp. This enabled us to analyze DNA extracted from archival material in the form of blocks of paraffin-embedded tissue. DNA from such a source is frequently degraded, and it is often only possible to amplify small molecules. This approach permitted us to use the considerable patient resources available as pathologic specimens. By using a mismatched primer in the PCR reaction we were able to genotype the samples using طقI restriction enzyme. This is a rapid, reliable, and inexpensive procedure that allowed efficient study of a large number of samples.

        The results demonstrated no difference in the prevalence of MS heterozygotes in the obstructed group compared with the nonobstructed. This result may reflect the fact that the S allele is a mild deficiency variant and if an increased risk of COPD is associated with the allele, it would be expected to be small. In some case–control studies an increased prevalence of MS genotypes in COPD patients has been reported (7, 8), whereas in others no association was found (12, 13, 15). Population studies have failed to detect increased risk of impaired lung function associated with the MS genotype (16, 18, 20-23). However, it is possible that the S allele may contribute to the susceptibility to COPD in conjunction with other factors (either genetic or environmental). The two individuals with the SS genotype had COPD, consistent with previous observations that this genotype is more prevalent in subjects with airway obstruction (7, 8).

        The Z allele causes a more severe deficiency of α1-antitrypsin, and the results of this study show that all of the MZ individuals in our population had COPD. This association was significant even after correction for potentially confounding factors such as age and smoking history. These results support previous studies that have suggested that the Z allele is a risk factor for COPD in the heterozygous state (7, 8, 10-15). The data indicate that intermediate deficiency of α1-antitrypsin enhances the decline in lung function that accompanies chronic exposure to cigarette smoke.

        In summary, we have used a novel study design to examine further the risk for COPD associated with S and Z heterozygosity. Although there was no increased risk for COPD associated with the presence of the S allele, we found that the prevalence of MZ individuals was increased in the COPD group compared with control subjects.