معلومة

تحول النيسرية السحائية إلى مسببات الأمراض

تحول النيسرية السحائية إلى مسببات الأمراض


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

قرأت مقال ويكيبيديا عن النيسرية السحائية، وهي تقول ذلك

N. السحائية هو جزء من النباتات الطبيعية غير المسببة للأمراض في البلعوم الأنفي لما يصل إلى 5-15٪ من البالغين

ومع ذلك ، فإنه في بعض الحالات يصيب مجرى الدم ، مما يؤدي إلى مرض المكورات السحائية وهو مرض مميت للغاية. قد يؤدي أيضًا إلى حدوث التهاب السحايا بالمكورات السحائية.

تقول المقالة أيضًا أن هذا المرض معدي إلى حد ما. ليست معدية مثل نزلات البرد ، ولكن من المعروف أنها تسبب الأوبئة في إفريقيا وآسيا.

سؤالي هو: كيف يمكن أن يكون بكثرة في شكله غير الممرض (حتى 15٪ من البالغين) ومع ذلك يسبب الأوبئة؟ يبدو أنه ينتقل من الأنف إلى الأنف بطريقة ما ولا يسبب مرضًا ، ولكن عندما يتسبب في مرض فإنه يتسبب أيضًا في حدوث مرض عند انتقاله.

انها ليست مثل سلالة بكتريا قولونية التي قد تسبب المرض لدى الأفراد الذين يعانون من كبت المناعة ولكنها جزء من الجراثيم الطبيعية لأشخاص آخرين. لأنه بعد ذلك لن يتسبب في الأوبئة ، لأن غالبية السكان محصنون ضدها كما يتضح من حقيقة أنها جزء من الكائنات الحية الدقيقة الخاصة بهم.

هل N. السحائية تحور لتصبح ممرضة؟ هل السلالة الأنفية والسلالة الممرضة لها أنماط وراثية مختلفة؟

حاولت البحث عن إجابة ولكن لم أجد أي إجابة.

شكرا جزيلا.


إنها ليست مثل سلالة من الإشريكية القولونية التي قد تسبب المرض للأفراد الذين يعانون من كبت المناعة ، ولكنها جزء من الميكروبات الطبيعية لأشخاص آخرين.

حسنًا ، في الواقع ، إنه نوع من هذا القبيل.

الإجابة معقدة ، ولكن يمكن تلخيصها في أن الأنماط المصلية الخبيثة من النيسرية السحائية تصيب السكان المعرضين للإصابة. للإجابة القصيرة ، ما عليك سوى القراءة بين المربعات المميزة.

ينتج مرض المكورات السحائية الغازية عن تفاعل: (1) العوامل الجرثومية التي تؤثر على فوعة الكائن الحي ، (2) الظروف البيئية التي تسهل التعرض والاكتساب ، و (3) عوامل حساسية المضيف التي تفضل اكتساب البكتيريا واستعمارها وغزوها وبقائها على قيد الحياة.

تحتوي الأنماط المصلية الخبيثة على كبسولات تساعدها على تجنب الاكتشاف والتدمير ؛ لديهم غلاف خارجي يساعدهم على غزو وإصابة الأفراد المعرضين للإصابة.

تتأثر ضراوة (14) من N. meningitidis بعدة عوامل: التعبير عن عديد السكاريد في الكبسولة ، والتعبير عن البروتينات اللاصقة السطحية (بروتينات الغشاء الخارجي بما في ذلك pili ، و porins PorA و B ، وجزيئات الالتصاق Opa و Opc) ، وآليات عزل الحديد ، والسموم الداخلية ( السكاريد الشحمي ، LOS). كما طورت N. meningitidis أيضًا آليات وراثية أدت إلى تبادل جيني أفقي ، ومرحلة عالية التردد ، وتباين مستضدي ، وتقليد جزيئي ، مما يسمح للكائن الحي بالتكيف بنجاح على الأسطح المخاطية وغزو العائل.

السكان الأكثر عرضة للإصابة هم الرضع / الأطفال (في أغلب الأحيان) والأطفال الصغار و غير محصنة الشباب (أثناء تفشي المرض). هؤلاء هم السكان الأكثر احتمالية لعدم وجود أجسام مضادة منخفضة ضد البكتيريا.

لا تزال المكورات السحائية سببًا شائعًا لالتهاب السحايا الجرثومي لدى الأطفال والشباب في الولايات المتحدة الأمريكية (132) ، وهي تؤثر في الغالب على الأطفال الذين تقل أعمارهم عن سنتين (102 ، 133). يحدث ثلثا مرض المكورات السحائية في السنة الأولى من العمر في الولايات المتحدة عند الرضع الذين تقل أعمارهم عن 6 أشهر (134). في جميع أنحاء العالم ، تعد معدلات الإصابة بمرض المكورات السحائية أعلى أيضًا بالنسبة للأطفال الصغار بسبب تضاؤل ​​الأجسام المضادة الوقائية للأم ، ولكن في حالات تفشي الوباء ، يمكن أن يكون لدى الأطفال الأكبر سنًا والمراهقين معدلات عالية من المرض. خمسون بالمائة من الحالات عند الرضع في الولايات المتحدة ترجع إلى المجموعة المصلية B. تظهر المجموعة المصلية C في الغالب في المراهقين والمجموعات المصلية B و Y عند كبار السن. على الرغم من حدوث الذروة بين الرضع والمراهقين ؛ ثلث إلى نصف الحالات المتفرقة تظهر في البالغين الأكبر من 18 عامًا.

لا تدوم حالة الناقل مدى الحياة أو حتى عامًا ، في الواقع ، يمكن أن تستمر لأقل من بضعة أسابيع.

عندما كان ما يقرب من 10 ٪ من الأفراد من عامة السكان في أي وقت يحملون N. meningitidis في البلعوم الأنفي (كارترايت وآخرون ، 1987) ، كان معدل النقل أقل من 3 ٪ في الأطفال الذين تقل أعمارهم عن 4 سنوات وزاد إلى 24 - 37٪ في الفئة العمرية 15-24 سنة .. ثم تنخفض معدلات النقل إلى أقل من 10٪ في الفئات العمرية الأكبر.

و

يزداد حمل المكورات السحائية بسرعة بين طلاب الجامعات في الشهر الأول من العام الدراسي وقد حدث جزء كبير من هذه الزيادة خلال الأسبوع الأول (نيل وآخرون ، 2000). أظهرت الدراسة ، التي أجريت في جامعة نوتنغهام بالمملكة المتحدة ، زيادة معدل النقل في الأسبوع الأول من الفصل الدراسي من 6.9٪ في اليوم الأول ، إلى 11.2٪ في اليوم الثاني ، إلى 19.0٪ في اليوم الثالث ، وإلى 23.1٪ في اليوم الرابع. وربما تسبب الاختلاط الاجتماعي المرتفع في هذه الزيادة.

تتأثر حالة الناقل بالأجسام المضادة الواقية ، والعوامل المخاطية المحلية ، وانخفاض ضراوة البكتيريا في الناقلات. المدخنون ، على سبيل المثال ، من المرجح أن يكونوا حاملين للعدوى أكثر من غير المدخنين. يؤثر نوع N. meningitidis أيضًا على الناقل مقابل الأفراد المصابين.

في النرويج ، ينتمي ما يقرب من 9٪ من عزلات النقل إلى اثنين من المجمعات النسيليّة شديدة الضراوة المعروفة ...

أي أنه من بين 100 حامل ، فإن أقل من 10٪ يحمل نوعًا شديد الضراوة. عدم الفوعة أو الفوعة هي القاعدة.

يمكن أن تصبح السلالة غير الخبيثة ضارة للآخرين من خلال مشاركة الحمض النووي.

بسبب الاستعمار المختلط مع البكتيريا الأخرى وبسبب مدته ، فإن الحالة الحاملة هي حالة مثالية لنقل الجينات الأفقي بين سلالات مختلفة من المكورات السحائية ، وبين المكورات السحائية وأنواع أخرى من البكتيريا المتعايشة. قد يؤوي البلعوم الأنفي البشري أنواعًا مختلفة من البكتيريا المسببة للأمراض ، مثل N. meningitidis و H.

مرة أخرى ، حاملو الأجسام المضادة لديهم أجسام مضادة واقية.

تعتمد المناعة ضد مرض المكورات السحائية الغازية على وجود الغلوبولين المناعي في الدم G (IgG) الذي يثير نشاط مبيد للجراثيم تجاه الكائن الحي المصاب. يمكن حماية الرضع من مرض المكورات السحائية من خلال وجود IgG الأمومي الذي يتم الحصول عليه بشكل سلبي أثناء الحمل والرضاعة. سيتم استبدال مناعة الأم بالحصانة المكتسبة. يزيد التعرض إلى النيسرية غير المسببة للأمراض والأنواع الأخرى المتفاعلة في البلعوم الأنفي من مستوى الأجسام المضادة المحددة أثناء الطفولة (Sanchez et al. ، 2001 ، 2002 ؛ Troncoso et al. ، 2000).

و

يرتبط حمل النيسرية المتعايشة ، وخاصة N. lactamica ، بمستوى عالٍ من الأجسام المضادة ضد N. meningitidis. توجد هياكل متجانسة للغاية في N. lactamica و N. meningitidis (Troncoso et al. ، 2000 ، 2001). تبين أن الأمصال المأخوذة من الفئران المحصنة بـ N. lactamica والمعززة بـ N. meningitidis تقتل المكورات السحائية.

... مناعة الغشاء المخاطي ليست قادرة على منع استعمار البلعوم الأنفي بواسطة المكورات السحائية ، لكنها تلعب دورًا مهمًا في منع غزو الخلايا الظهارية (Griffiss ، 1995).

إذا كان هذا يجيب على سؤالك ، فهذا ما كنت أتمناه ، لأن الباقي لغزا بالنسبة لي. لكن تذكر أنك لست حاملًا مدى الحياة. قد تكون حاملًا لمدة أسابيع ، وكل تعرض لنمط مصلي غير ضار يزيد من مناعتك.

النيسرية السحائية: علم الأحياء وعلم الأحياء الدقيقة وعلم الأوبئة
Neisseria meningitidis: نظرة عامة على حالة النقل


الفصل السابع: تحديد وتوصيف النيسرية السحائية

N. السحائية هي مكورات مضاعفة سالبة الجرام على شكل حبة البن والتي قد تحدث داخل الخلايا أو خارجها في كريات الدم البيضاء PMN. N. السحائية هو كائن حساس ، ينمو بشكل أفضل في 35-37 درجة مئوية مع

5٪ كو2 (أو في جرة شمعة). يمكن أن ينمو على كل من صفيحة أجار الدم (BAP) ولوحة أجار الشوكولاتة (CAP). مستعمرات N. السحائية رمادية اللون وغير مصبوغة على BAP وتبدو مستديرة وناعمة ورطبة ولامعة ومحدبة ، مع حافة محددة بوضوح. N. السحائية تظهر كمستعمرات كبيرة ، عديمة اللون إلى الرمادي ، معتمة على CAP. قبل إجراءات اختبار التحديد والتوصيف ، يجب دائمًا فحص العزلات للتأكد من نقاء النمو ، ويجب إعادة تخطيط مستعمرة واحدة ، عند الضرورة ، للحصول على ثقافة نقية. بالنسبة لإجراءات التحديد والتوصيف التالية ، يجب إجراء الاختبار على نمو 18-24 ساعة من BAP (الشكل 1) أو CAP (الشكل 2) عند 35-37 درجة مئوية مع

يوصى بإجراء الاختبارات التالية لتأكيد هوية الثقافات التي تظهر شكليًا N. السحائية (الشكل 3). N. السحائية يمكن التعرف عليه باستخدام اختبار Kovac & rsquos oxidase واستخدام الكربوهيدرات. إذا كان اختبار أوكسيديز إيجابيًا ، فيجب إجراء اختبار استخدام الكربوهيدرات. إذا كان اختبار استخدام الكربوهيدرات يشير إلى أن العزلة قد تكون كذلك N. السحائية، يجب إجراء الاختبارات المصلية لتحديد المجموعة المصلية. يعد هذا التسلسل من الاختبارات وسيلة فعالة لتوفير الوقت والمضاد المكلف. طرق إضافية لتحديد وتوصيف N. السحائية استخدام الأدوات الجزيئية موصوفة في الفصل 10: طرق PCR والفصل 12: الطرق الجزيئية.

ممارسات السلامة الحيوية من المستوى 2 (BSL-2) مطلوبة للعمل الذي يشمل عزلات N. السحائية، لأن هذا الكائن الحي يمثل خطرًا محتملاً على العاملين في المختبر وبيئة العمل المحيطة. يرجى الرجوع إلى الفصل 4: السلامة الحيوية من أجل اتباع الإرشادات التي تم وضعها للعمال العاملين في مرافق BSL-2 حيث أن العديد من الاختبارات الموصوفة في هذا الفصل تتطلب لوحات مفتوحة مع ثقافات حية وغالبًا ما يتم إجراؤها خارج خزانة السلامة الأحيائية ( BSC). الأدوات الجزيئية موصوفة في الفصل 10: طرق PCR والفصل 12: الطرق الجزيئية.

شكل 1. N. السحائية المستعمرات على BAP

الشكل 2. N. السحائية المستعمرات في CAP

الشكل 3. مخطط انسيابي لتحديد وتوصيف أ N. السحائيعزل

  1. اختبار Kovac & rsquos oxidase يحدد اختبار Kovac & rsquos أوكسيديز وجود السيتوكروم أوكسيديز. يتحول كاشف Kovac & rsquos oxidase ، رباعي ميثيل- p-phenylenediamine ثنائي هيدروكلوريد ، إلى مركب أرجواني عن طريق الكائنات الحية التي تحتوي على السيتوكروم ج كجزء من سلسلة الجهاز التنفسي. يساعد هذا الاختبار في التعرف على N. السحائية، ولكن أعضاء آخرين من الجنس النيسرية ، بالإضافة إلى الأنواع البكتيرية غير ذات الصلة ، قد تعطي أيضًا تفاعلًا إيجابيًا. يجب اختبار سلالات مراقبة الجودة الإيجابية والسلبية (QC) جنبًا إلى جنب مع العزلات غير المعروفة للتأكد من أن كاشف أوكسيديز يعمل بشكل صحيح.
    1. تحضير 1٪ أوكسيديز كاشف من مسحوق أوكسيديز لمنع تلف مسحوق أوكسيديز المخزون ، يجب تخزين المسحوق في مجفف محكم الإغلاق وحفظه في مكان بارد ومظلم. كاشف Kovac & rsquos oxidase مخصص فقط ل في المختبر استخدام التشخيص. تجنب ملامسة العينين والجلد لأنه قد يسبب تهيجًا. في حالة التلامس العرضي ، اغسل العين أو الجلد على الفور بالماء لمدة 15 دقيقة على الأقل.
      1. قم بإعداد كاشف أوكسيديز Kovac & rsquos 1.0٪ بإذابة 0.1 جم من ثنائي هيدروكلوريد رباعي ميثيل- p-phenylenediamine في 10 مل من الماء المقطر المعقم.
      2. تخلط جيدا ثم تترك لمدة 15 دقيقة.
        • يجب أن يكون المحلول طازجًا يوميًا ويجب التخلص من الجزء غير المستخدم.
        • وبدلاً من ذلك ، يمكن توزيع الكاشف في قسامات سعة 1 مل وتخزينها مجمدة عند درجة حرارة -20 درجة مئوية. يجب إزالة الكتل من الفريزر وإذابتها قبل الاستخدام. تجاهل الجزء غير المستخدم كل يوم يتم إذابة الكاشف.
      طريقة ورق الترشيح

      الشكل 4. اختبار أوكسيديز Kovac: رد فعل سلبي وإيجابي على طريقة لوحة ورق الترشيح

      طريقة اللوحة
      • لا تغمر الصفيحة بأكملها لأن البكتيريا المعرضة للكاشف عادة ما تكون غير قابلة للحياة للثقافة الفرعية.
      • ستتطور التفاعلات الإيجابية في غضون 10 ثوانٍ على شكل لون أرجواني حيث تم وضع البكتيريا على ورق الترشيح المعالج. من غير المحتمل مع ردود الفعل المتأخرة N. السحائية.
      • لن تؤدي التفاعلات السلبية إلى تغيير لون ورق الترشيح المعالج.

      الشكل 5. تفاعلات سكر CTA ل N. السحائية مع استخدام الجلوكوز (الدكستروز) والمالتوز ، والمشار إليه بإنتاج الحمض (تغير اللون إلى الأصفر) ، وعدم استخدام اللاكتوز أو السكروز

      الجدول 1. استخدام الكربوهيدرات من قبل البعض النيسرية و موراكسيلا النيابة.

      إنتاج الحمض من:
      الجدول 1. استخدام الكربوهيدرات من قبل بعض النيسرية والموراكسيلا.
      الكائن الحي الجلوكوز 1 مالتوز اللاكتوز السكروز
      النيسرية السحائية + + & - & -
      النيسرية لاكتاميكا + + + & -
      النيسرية البنية + 2 & - & - & -
      النيسرية السيكا + + & - +
      الموراكسيلا النزلية & - & - & - & -

      الحواشي

      • 1 يمكن أيضًا الإشارة إلى الجلوكوز باسم سكر العنب.
      • 2 بعض سلالات N. gonorrhoeae هي من منتجي حمض ضعيف وقد يبدو أنها سالبة للجلوكوز في وسط CTA.
      • ستتطلب كل عزلة العديد من الأقسام الموجودة على الشريحة مثل الأمصال المضادة الفردية الخاصة بالمجموعة المصلية التي سيتم اختبارها بالإضافة إلى عنصر تحكم سلبي ملحي.
      • تحدد التعليمات استخدام المرشح الصغير مع أطراف مفلترة معقمة لقياس 10 وماكرول من محلول ملحي فورمالين بنسبة 5٪ لتعليق البكتيريا. سوف ينقل ميكروبيبيتور قياسات دقيقة ومتساوية لتفاعل SASG المناسب.
      • في حالة عدم توفر المرشح الصغير والنصائح ، يمكن استخدام حلقات التلقيح المعقمة التي يمكن التخلص منها من 10 وماكرول لنقل 10 ميكرول من المحلول الملحي فورمالين بنسبة 5٪ ، ولكن غالبًا لا تقدم كميات دقيقة (بين 5-10 وماكرول).
      • إذا كان من الصعب تعليق البكتيريا مباشرة على الشريحة ، اصنع تعليقًا معتدلًا حليبيًا (يمكن مقارنته بمعيار McFarland 6) من ثقافة الاختبار في قنينة صغيرة تحتوي على 250 ومايكروول من محلول ملحي فورمالين بنسبة 5٪ ودوامة معلقة لفترة وجيزة للخلط والتفكك أي حبيبات. أضف 10 ميكرول من هذا التعليق إلى الجزء السفلي من الشريحة.
      • لا تستخدم القطارة المرفقة مع الأمصال المضادة لأنها عادةً ما توفر كميات أكبر مما هو ضروري ويمكن أن تتلوث بسهولة.
      • في حالة عدم توفر المرشح الصغير والنصائح ، يمكن استخدام حلقات التلقيح المعقمة التي يمكن التخلص منها من 10 وماكرول لنقل 10 ميكرول من الأمصال ، ولكن غالبًا لا تقدم كميات دقيقة (بين 5-10 وماكرول).
      • تخلص من الطرف أو الحلقة المستخدمة لنقل المادة المضادة إلى الشريحة في حاوية نفايات بعد كل استخدام لتجنب تلوث المضاد. إذا كان مصدر الأمصال ملوثًا ، يجب استخدام قنينة جديدة.

      الشكل 6. تقييم شدة رد فعل التراص

      • يتم تحديد النتيجة الإيجابية من خلال 3+ أو 4+ (تراص قوي) في غضون 1-2 دقيقة ، باستثناء المجموعة المصلية B ، والتي تعتبر إيجابية مع تصنيف 2+ أو أعلى.
      • يتم تحديد النتيجة السلبية بواسطة 0 (محلول ملحي) أو +/- أو 1+ أو 2+ (تراص ضعيف).
      • يتم تحديد المجموعة المصلية عندما تحدث نتيجة إيجابية مع مضاد واحد فقط وليس مع محلول ملحي.
      • إذا لم يتم تحديد مجموعة مصلية ، تعتبر العزلة NG. تم الإبلاغ عن تركيبات النتائج التالية على أنها NG:
        • التراص في المحلول الملحي ، بغض النظر عن التفاعلات القوية مع الأمصال المضادة الأخرى ، يميز المزرعة على أنها تراص تلقائي.
        • التراص مع أكثر من مضاد واحد خاص بالمجموعة المصلية في حالة عدم وجود تراص في محلول ملحي يميز المزرعة على أنها متعددة التراص أو تفاعلية متبادلة.
        • لا يوجد تراص مع أي من الأمصال المضادة أو المحلول الملحي يميز السلالة بأنها غير تفاعلية.
        1. كرر الاختبار مباشرة على الشريحة باستخدام النمو من قسم آخر من نفس اللوحة.
        2. قم بعمل تعليق خلية في أنبوب صغير ودوامة إذا كانت النتيجة من SASG مباشرة على الشريحة غير واضحة وكرر الاختبار.
        3. أضف 20 ميكرول من الأمصال مباشرة إلى الشريحة ثم أضف حلقة ممتلئة بالكائن الحي دون تمييع العينة بمحلول ملحي فورمالين بنسبة 5٪.
        4. ثقافة فرعية وإعادة اختبار النمو الطازج في اليوم التالي.
        5. إذا كان الطبق الأصلي يحتوي على مستعمرات مختلفة الحجم ، فقم بعمل ثقافة فرعية لكل نوع من المستعمرات واختبر كلتا الثقافتين في اليوم التالي. تشير المستعمرات الكبيرة عادة إلى إنتاج أفضل للكبسولات وبالتالي تفاعل أفضل. ومع ذلك ، فإن المستعمرات الأصغر ستعطي أحيانًا نتيجة أفضل.
          • إذا لم يتم حل التناقضات على الفور ، فيجب استخدام أي تكرار لاحق لـ SASG بالتزامن مع سلالات التحكم.
        • يتم إجراؤه لكل دفعة جديدة من الأمصال المضادة التي يتم تلقيها في المختبر.
        • يتم إجراؤه مرتين سنويًا بعد اختبار ضبط الجودة الأولي.
        • كرر إذا تعرضت القارورة لدرجات حرارة أعلى من 4 درجة مئوية أو إذا كان هناك سبب للشك في أن القارورة قد تلوثت منذ إجراء مراقبة الجودة الأولية.

        اتبع إجراء اختبار SASG لمراقبة الجودة لكل دفعة من الأمصال المضادة باستخدام جميع السلالات المرجعية المتاحة في المختبر. سجل النتائج المقدمة في ورقة مثال مراقبة الجودة في الشكل 7.

        قراءة نتائج اختبار مراقبة الجودة
        • يجب أن يعطي المصل المضاد 3+ أو 4+ تراص مع مستضدات متجانسة في غضون 1-2 دقيقة.
        • يجب ألا يتفاعل المصل مع غير المتجانسة N. السحائية مجموعات مصلية ، مع سلالة مرجعية NG ، أو في محلول ملحي.
        • يتراكم المصل المضاد مع سلالة مرجعية واحدة أو أكثر و / أو مع سلالة مرجعية NG و / أو في محلول ملحي.

        الشكل 7. مثال على ورقة مراقبة الجودة لاختبار الأمصال ضد الكل N. السحائية المجموعات المصلية


        الوبائيات

        على الصعيد العالمي ، تحدث الغالبية العظمى من مرض المكورات السحائية لدى الأفراد المؤهلين مناعياً عن سلالات من ثلاثة المجموعات المصلية - يسود مرض A و B و C. Serogroup A في "حزام التهاب السحايا" في أفريقيا جنوب الصحراء الكبرى ، في الشرق الأوسط ، وآسيا ، وفي بعض البلدان الاستوائية الأخرى. في بلدان خطوط العرض الأعلى بما في ذلك قارة أمريكا الشمالية وأوروبا وأستراليا ، المجموعات المصلية يسود B و C. في الولايات المتحدة ، سلالات من مجموعة مصلية تسبب Y ما يقرب من ثلث الحالات ، مع ميول غير عادية لكبار السن والتسبب في عدوى الجهاز التنفسي السفلي.

        تختلف معدلات الهجوم بشكل كبير حسب المنطقة والبلد وبمرور الوقت. غالبًا ما تكون معدلات المرض الإجمالية في بلدان خطوط العرض الأعلى حوالي 1-2 لكل 10 5 من السكان ، ولكن المعدلات الأعلى ليست غير شائعة من وقت لآخر.في الولايات المتحدة ، كانت معدلات الهجوم أقل من 1 لكل 10 5 من السكان لبعض السنوات (3 ، 14). يمكن أن تسبب المكورات السحائية مجموعات من الحالات في العائلات والمدارس والجامعات ومؤسسات التدريب العسكري. يمكن أن تسبب أيضًا فاشيات أكثر انتشارًا على مستوى المجتمع والتي عادة ما تكون بسبب سلالات من نوع نسيلي واحد. لعدة سنوات في التسعينيات ، كان هناك تفشي لمرض المجموعة المصلية W بين المسلمين الذين يزورون المملكة العربية السعودية أثناء أداء فريضة الحج أو العمرة. تم السيطرة على تفشي المرض من خلال إدخال التطعيم الإجباري للحجاج الزائرين.

        بشكل عام ، تكون معدلات الهجوم أعلى في صغار السن ، حيث تبلغ ذروتها في حوالي 7 أشهر ثم تنخفض بثبات إلى سن 10 سنوات ، تليها ذروة ثانية وأصغر في سن المراهقة المتأخرة (33). حدوث المرض عند البالغين منخفض. عادة ما تظهر نسبة الجنس للحالات رجحان ضئيل للذكور.

        الرضع ، الذين يكون انتشار الأجسام المضادة الواقية بينهم منخفضًا ، نادرًا ما يصابون بالمكورات السحائية عندما يصابون بها ، فإن فرص الإصابة بالأمراض الغازية عالية. قد ترتبط ذروة المرض الثانية عند المراهقين والشباب بقمة النقل ، والأهم من ذلك ، ذروة الاكتساب التي تحدث في هذا العمر.

        تحدث أوبئة البنكرياس الهائلة الناتجة عن سلالات المجموعة المصلية A في أفريقيا جنوب الصحراء الكبرى (ما يُسمى & quotmeningitis belt & quot) على فترات تتراوح من 5 إلى 10 سنوات مع معدلات هجوم تبلغ 100 أو أكثر لكل 10 5 من السكان. ويرجع ذلك إلى إدخال ونشر مستنسخات جديدة من المكورات السحائية بين السكان المعرضين للإصابة (2).


        تأثير السيليكا المسامية تحت عملية تحول النيسرية السحائية: التأثيرات البيئية تحت تحول المكورات السحائية

        خلفية: هدفت هذه الدراسة إلى استخدام السيليكا متوسطة المسام تحت Neisseria meningitidis القابل للتحول بشكل طبيعي ، وهو عامل ممرض مهم متورط في النقل الأفقي الجيني للحمض النووي مما تسبب في هروب إجراءات التطعيم الرئيسية في جميع أنحاء العالم من خلال عملية التبديل المحفظي. تحققت هذه الدراسة من آثار السيليكا المسامية في ظل تحول النيتروجين السحائي على وجه التحديد تحت استبدال المحفظة.

        أساليب: استخدمنا ثلاث جسيمات سيليكا مسامية مختلفة للتحقق من عملها في تردد تحويل التهاب السحايا N.

        نتائج: لقد تحققنا من الزيادة في استبدال الجين المحفظي لهذه البكتيريا بجسيمات السيليكا النانوية المتوسطة المسامية.

        استنتاج: كانت جزيئات السيليكا المتوسطة المسامية قادرة على زيادة تكرار استبدال الكبسولة في N. meningitidis.


        يعمل على N. السحائية في ليستر

        يقوم الدكتور كريس بايليس ، من قسم علم الوراثة وبيولوجيا الجينوم ، ومجموعته بدراسة الجينات التي يقوم عليها نجاح N. meningitidis باعتباره أحد مسببات الأمراض البشرية الرئيسية. المجالات الرئيسية للدراسة هي الدراسات الوبائية لتوزيع السلالات وانتشارها ، والمعلوماتية الحيوية لتسلسل الجينوم الكامل ، وتحليل النمط الظاهري للسلالات وعلم اللقاحات. ينصب التركيز الرئيسي على تباين الطور في هذا النوع.

        علم الأوبئة

        شاركت مجموعة الدكتور بايليس في إنتاج مجموعات كبيرة من عزلات المكورات السحائية من طلاب الجامعات الذين تم استعمارهم بدون أعراض مع N. meningitidis. الملاحظات: - يحدث نقل سلالة واحدة لمدة 6 أشهر في 45٪ من الناقلين الذين اكتشفوا انتشارًا مرتفعًا لسلالات MenY في 2008-2011 حمل سلالات MenW في الأفراد الملقحين والتضخيم السريع لاستنساخ MenW ST-11 خلال الفترة القليلة الأولى أشهر الحياة الجامعية في 2015-2016.

        المعلوماتية الحيوية

        طورت مجموعة الدكتور بايليس PhasomeIt لاكتشاف الجينات ذات الطور المتغير في تسلسل الجينوم الكامل. باستخدام هذه الأداة ، وجد أن أنواع النيسرية المسببة للأمراض (المكورات السحائية والمكورات البنية) والأنواع المتعايشة N. lactamica لديها العديد من الجينات المتغيرة الطور أكثر من الأنواع النيسرية الأخرى مما يشير إلى أن الكهروضوئية تساهم في استعمار المضيف واستمراره. أظهرت هذه المجموعة أيضًا أن استنساخًا فرعيًا لـ MenW ST-11 طور مسارات تكرار أطول في جينات متعددة ترميز بروتينات سطحية ، وهي ظاهرة من المحتمل أن تزيد من معدل PV وتسهل انتقال الإجهاد.

        تحليلات النمط الظاهري

        الأدوات الرئيسية: - زراعة الخلايا ، ثقافة الدم الكامل ومقايسات مصل الجراثيم. الملاحظات الرئيسية: - إثبات أن البروتين المرتبط بالترانسفيرين ضروري لنمو المكورات السحائية في المسالك المتكررة لدم الإنسان في بورا ، وهو بروتين غشاء خارجي رئيسي ، يتوسط الهروب من الأجسام المضادة للجراثيم الخاصة بـ PorA عن طريق تغيير التعبير السطحي لهذا البروتين.

        اختلاف المرحلة

        وجدت الدراسات الوبائية ارتباطًا بين النقل المستمر والتخفيضات بوساطة PV في التعبير عن البروتينات السطحية أحادية النسخة ، والتي ربما تكون مدفوعة بالاستجابات المناعية للمضيف. أظهرت هذه الدراسات أيضًا أن PV لبروتينات Opa متعددة النسخ تؤدي إلى التبديل بين البروتينات المتباينة مستضديًا أثناء النقل مع الحفاظ على الخصائص اللاصقة لهذه البروتينات. تم العثور أيضًا على عزلات مرض المكورات السحائية تحتوي على بروتينات PilC متوقفة عن التشغيل بينما يرتبط النقل المستمر بالتبديل من PilC1 إلى PilC2.

        علم اللقاحات

        تم إدخال لقاح Bexsero & reg ، وهو لقاح MenB ، في جدول تحصين الأطفال في نهاية عام 2015. بتمويل من مؤسسة أبحاث التهاب السحايا ، قام الدكتور بايليس ومجموعته بتقييم كيفية مراقبة برنامج التحصين Bexsero & reg. من خلال التركيز على التسلسلات التي تتحكم في التعبير عن بروتين رابط العامل H (أحد مستضدات اللقاح) ، تم إنشاء مناهج جديدة للمساعدة في فهم ومراقبة أداء هذا اللقاح في جميع حالات المرض.


        نتائج

        تأثير حذف dprA on Nm القابلية للتحويل

        أ dprA تم بناء متحولة خالية من سلالة Nm MC58. شرط وظيفي dprA تم توضيح موضع التحول في Nm [10] وكذلك في Ng [17]. لاختبار دور DprAنانومتر في التحول مع تركيبات مختلفة من ركيزة الحمض النووي ، من النوع البري و dprA تم تحويل الخلايا الطافرة الفارغة باستخدام DNA البلازميد الدائري أو الحمض النووي الكروموسومي أو الحمض النووي الصبغي الخطي المضخم بواسطة PCR ، وكلها تحتوي على متطابق. بيلج & # x0200a:: & # x0200aكان إدراج. في الخلفية البرية ، لوحظت مستويات التحول 7.10 & # x000d710 & # x022125 و 1.43 & # x000d710 & # x022126 و 6.75 & # x000d710 & # x022126 للحمض النووي الجيني والحمض النووي الخطي وركيزة DNA البلازميد ، على التوالي. في ال dprA خلفية فارغة ، كانت معدلات التحويل غير قابلة للاكتشاف تقريبًا (حد الكشف: 1 & # x000d710 & # x022128) (الشكل 1).

        DprA مطلوب تمامًا لتحويل الحمض النووي في النيسرية السحائية (نانومتر). يظهر التباين في التحويل الكمي للنوع البري Nm MC58 و MC58 dprA & # x0200a:: & # x0200aأف مع DUS الذي يحتوي على DNA الجينومي والحمض النووي الخطي وركائز DNA البلازميد. القيم الموجودة على ذ-المحور على مقياس لوغاريتمي. يشار إلى الانحرافات المعيارية من خمس تجارب مستقلة على الأقل بواسطة الأشرطة.

        لا أثر لحذف dprA on nm إصلاح الحمض النووي أو إعادة التركيب

        البرية من نوع و dprA تم تعريض الخلايا الفارغة لعوامل ألكلة الحمض النووي ميتوميسين C (MMC) وميثيل ميثان سلفونات (MMS) ، والعامل المؤكسد ثنائي كلوريد باراكوات (PQT) (الشكل 2). مقارنة معدل البقاء على قيد الحياة بين النوع البري و dprA الخلايا الطافرة الفارغة بعد التعرض لهذه العوامل المدمرة للحمض النووي لم تكشف عن أي فرق. ومع ذلك ، سلالة تحكم ناقصة إعادة التركيب ، M1080 recA6 (M400) ، أظهر انخفاضًا كبيرًا في معدل البقاء على قيد الحياة (ص& # x022640.001 ، للطالب ر-اختبار). هذا يشير إلى أن DprAنانومتر قد يكون له دور ضئيل أو معدوم في إصلاح تلف الحمض النووي المؤلكل أو المؤكسد.

        ال النيسرية السحائية (نانومتر) & # x00394dprA المتحولة لم تظهر فرقًا كبيرًا عن النوع البري عند تعرضها لعوامل مدمرة للحمض النووي. Nm MC58 من النوع البري و & # x00394dprA تم تعريض المسوخ لباراكوات 0.1 & # x02009mM و 0.5 متر M MMS و 10 & # x02009ng ml & # x022121 MMC. M1080 recA6 (أي يحفز IPTG recA، ولكن بدون إضافة IPTG) كعنصر تحكم ناقص في إعادة التركيب ، وأظهر انخفاضًا كبيرًا في معدل البقاء على قيد الحياة. يشار إلى الانحرافات المعيارية للوسيط من ثلاث تجارب مستقلة بواسطة أشرطة.

        تم تقييم تطور دورة الخلية أيضًا في Ng dprA سلالات متحولة فارغة وسلالة من النوع البري عن طريق قياس التدفق الخلوي ، والتي قدمت معلومات عن محتوى الحمض النووي والبروتين لكل خلية ، وعدد معادلات الكروموسوم لكل خلية. كل من النوع البري و & # x02206dprA أظهرت سلالات متحولة كتلة خلية متساوية وتحتوي على أعداد متساوية من معادلات الكروموسوم ، قبل وبعد علاجات ريفامبيسين وسيفاليكسين (CPX). ومع ذلك ، فإن محتوى الحمض النووي لـ & # x00394dprA تأثرت الخلايا الطافرة بشكل كبير بعد تعرض ريفامبيسين و CPX لمحتوى الحمض النووي لـ & # x00394dprA كانت الخلايا الطافرة 242 ، والخلايا من النوع البري 277 (التألق في الوحدات التعسفية ، AU) (ص= 0.02 ، الطالب & # x02019s ر-اختبار). على الرغم من أنه لم يكن مهمًا ، إلا أن المرحلة الثابتة غير المعالجة & # x00394dprA تحتوي الخلايا المتحولة أيضًا على كميات أصغر من الحمض النووي (247 AU) من الخلايا البرية (276 AU) (ص= 0.109 ، الطالب & # x02019s ر-اختبار) (الجدول 1 والشكلان S2 و S3).

        الجدول 1.

        سلالاتDNA لكل خليةالكتلة لكل خليةمحتوى الحمض النووي النسبيالكتلة النسبية
        MS11wt2761391.001.00
        MS11 & # x00394dprA2471130.890.81
        MS11wt ++ 277941.001.00
        MS11 & # x00394dprA ++ 242910.870.97

        ++ , السلالات المعالجة بالريفامبيسين والسيفاليكسين.

        تشابه DprAنانومتر لأخصائيي تقويم العظام المتميزين

        تسلسل الحمض الأميني المستنتج لـ DprAنانومتر تم محاذاة مع تسلسلات من DprASp و هيليكوباكتر بيلوري DprA (DprAحصان) ، مما يكشف عن مستوى عالٍ من التماثل (هوية 38 و 30 & # x0200a٪ ، على التوالي) على مستوى البروتين (الشكل 3). لوحظ أيضًا حفظ التسلسل بين المجالات (الشكل S4) ، وإن كان بدرجة معينة من الاختلاف على سبيل المثال ، SAM لـ DprAنانومتر لديه هوية 32 & # x0200a٪ مع DprAر سام. DprAنانومتر يحتوي مجال RF على هوية تسلسل 36 و 45 و 47 & # x0200a ٪ مع RFs لـ DprAحصانو DprARp و DprASp، على التوالي (الشكل 3 أ و # x02013c). ال dprAتمت محاذاة متواليات النوكليوتيدات والبروتين DprA من سلالات 6 نانومتر ، وكشف عن 67 تعدد الأشكال ، بما في ذلك 47 nsSNPs (الشكل S5a). ومع ذلك ، حددت تنبؤات التأثير على وظيفة البروتين باستخدام SNAP2 أن 46/47 (98 & ​​# x0200a٪) من SAPs كانت متحفظة. تم توقع أن يكون لـ SAP فقط في الموضع 247 تأثير على وظيفة DprA ، مع درجة 45 ودقة متوقعة تبلغ 71 & # x0200a٪ (الشكل S5b). استنادًا إلى النماذج الهيكلية المنشورة لـ DprAحصان و DprASp [21 ، 31] والبيانات الفيزيائية الحيوية المرتبطة بها [20] ، نتوقع أن يتم حفظ واجهة dimerization (يطلق عليها & # x02018C / C & # x02019) [21] في DprAنانومتر (الشكل ثلاثي الأبعاد). Quevillon-Cheruel وآخرون. أسس أهمية هذه الواجهة لتشكيل مجمع ركيزة الدنا وتحويلها [21].

        مقارنة المعلوماتية الحيوية من DprAنانومتر مع تقويم العظام & # x02013 العقدية الرئوية (DprASp), هيليكوباكتر بيلوري (DprAحصان) و Rhodopseudomonas palustris (DprAر). (أ) هيكل المجال العام المتوقع لجميع أخصائيي تقويم العظام الأربعة DprA. (ب) مؤامرة التشابه لـ DprAنانومتر تسلسلات ذات أحجام نافذة منزلقة (ث) تتراوح من 4 إلى 20 أأ. تم ضبط متوسط ​​التشابه في التسلسل بأكمله على 1. تم تحديد حدود الأشكال الثلاثة باللون البرتقالي. (ج) استنتاج محاذاة تسلسل الأحماض الأمينية لمجال DprA المميز ، RF ، من DprASp، DprAحصان و DprAنانومتر. المخلفات الوظيفية المقترحة تجريبياً من DprASp و DprAحصان ملونة. لونان يعنيان وظيفتين. تشير الأسهم إلى مخلفات وظيفية مثبتة تجريبياً من الأنواع الأخرى المحفوظة في DprAنانومتر. يوضح الرقم الموجود أسفل كل سهم رقم المخلفات بالنسبة إلى الطرف N لـ DprAنانومتر. (د) المونومر المتوقع & # x02013monomer التفاعل من DprA من سلالة Nm MC58. تظهر مخلفات واجهة Dimerization باللون الأصفر. SAM ، عزر ألفا معقم Z & # x003b1 ، عزر ربط الحمض النووي الحلزوني المجنح / مجال ربط Z-DNA.

        DprAنانومتر يربط الحمض النووي

        تم إجراء EMSA لتحليل تقارب DprA المؤتلف من أجل ركائز الحمض النووي أحادية النوكليوتيد (ss) أحادية الشريطة أو مزدوجة الشريطة (ds). تم استخدام أليغنوكليوتيدات بوليمر متجانسة (dT) بأطوال مختلفة (dT12 & # x02013dT100) وكان dT40 كافياً لـ DprA لتكوين مركب بروتين نووي بسهولة ، على الرغم من أن المعقد ينفصل بسهولة أثناء الرحلان الكهربائي (الشكل 4 أ). تقارب DprAنانومتر لركيزة الحمض النووي زادت مع زيادة طول ssDNA oligo ، والحمض النووي المستقر للغاية & # x02013DprAنانومتر مركب يتكون من dT80 (الشكلان 4 أ و S6a). ما لم يُذكر خلاف ذلك ، تم إجراء تجارب EMSA الموضحة أدناه باستخدام ركيزة DNA 80 & # x02009nt أو 80 & # x02009bp في الطول (يتم عرض الخصائص والتسلسلات الفيزيائية في الجدولين 2 و S3). DprAنانومتر يربط ssDNA (C80) بتقارب أعلى بكثير (ص= 0.034 ، للطالب ر-اختبار) (الشكل 4 ب) مما يربط dsDNA (G80C80) (الشكلان 4 ج و S6 ب).

        تحليل مقايسة التحول الحركية الكهربائية النيسرية السحائية (نانومتر) DprA DNA مرتبط بركائز DNA ذات أطوال مختلفة. تم اكتشاف زيادة تقارب الربط لـ DprA مع زيادة طول قليل النوكليوتيدات عندما تم احتضان 30 & # x02009nM من DprA باستخدام بولي (T) (dT) قليل النوكليوتيد (dT12 & # x02013dT100) (أ). DprA المرتبط بـ ssDNA (C80) مع تقارب أقوى (ب) مقارنة بـ dsDNA (G80C80) (ج) ، عندما تم تحضين تركيز متزايد من DprA في (نانومتر) مع 1000 c.p.m. & # x000b5l & # x022121 من [& # x003b3 32 P] ssDNA المسمى ATP (C80) و dsDNA (G80C80) ، على التوالي. المسار 1 ، لا يوجد حارة البروتين 2 ، 0.5 حارة 3 ، 1.25 حارة 4 ، 2.5 حارة 5 ، 5 حارة 6 ، 10 حارة 7 ، 20 حارة 8 ، 30 حارة 9 ، 40 حارة 10 ، 50 حارة 11 ، 60 حارة 12 ، 70 و بروتين 13، 80 & # x02009nM.

        الجدول 2.

        ثابت فيزيائيGTB25ق 80
        طول قليل النوكليوتيد8080
        الوزن الجزيئي (kDa)24.724.5
        محتوى G + C (٪)5849
        درجة حرارة الانصهار (& # x000b0C)8076
        & # x00394جي (كيلو كالوري مول & # x022121) *131.1117.2

        تقارب DprAنانومتر تمت مقارنة C80 مع تقاربها مع قليل القسيمات يحتوي على تسلسل امتصاص الحمض النووي (DUS) ، GTB. تظهر النتائج أن DprAنانومترتقارب & # x02019s لـ C80 و GTB25 متشابه ، على الرغم من أن حركة ركيزة الحمض النووي المرتبطة بالبروتين أثناء EMSA كانت مختلفة قليلاً ، أي DprAنانومتر& # x02013C80 تم ترحيلها بشكل أسرع من DprAنانومتر& # x02013GTB25 (الشكلان 5 أ و S7). تم إجراء فحوصات الربط التنافسية ، حيث تم تحضين 32 GTB25 أو C80 المسمى بـ P-end المسمى مسبقًا بـ DNA منافس غير موسوم ، C80 أو GTB ، على التوالي ، أو العكس. تؤكد النتائج أن DprAنانومتر يرتبط بـ DUS الذي يحتوي على GTB25 و C80 مع تقارب مماثل [الشكل 5 ب (i & # x02013iv)]. ومن المثير للاهتمام ، أن الارتباط بأوليجومير المسمى كان مستقرًا في وجود ما يصل إلى

        15 & # x02009nM DNA منافس ، وهو ما يعادل ما يقرب من 160 ضعفًا من المولي الزائد من منافس غير محدد. استقرار DrpAنانومترانخفض oligomer المسمى المربوط عندما تجاوز تركيز الحمض النووي الكلي 15 & # x02009nM ، وعند هذه النقطة ظهر شريط إضافي يحتوي على أوليغومير (B2) خلال EMSA ، مع إمكانية التنقل بين النطاق (B1) والحمض النووي الحر (الشكلان S8 و # x02013S11).

        يعرض DprA ارتباط الحمض النووي المستقل عن التسلسل. (أ) صور جل تمثيلية تظهر تركيزًا متزايدًا لبروتين DprA المؤتلف (نانومتر) المحتضن بـ 1000 & # x02009c.p.m. & # x000b5l & # x022121 من [& # x003b3 32 P] ATP المسمى (ساخن) C80nt (i) و GTB25 (ii) و C80G80 (iii) و GTB25 / 26 (iv). لين 1 & # x02013 لا بروتين. الممرات 2 و 5 و 8 و 11 & # x02013 20 & # x02009nM. الممرات 3 و 6 و 9 و 12 & # x02013 30 & # x02009nM. الممرات 4 و 7 و 10 و 13 & # x02013 40 & # x02009nM. (ب) القياس الكمي لمقايسة نقل الحركة الكهربي التنافسية (بالنسبة للصور الهلامية ، انظر الأشكال S11) ، حيث تنافس بروتين DprA المؤتلف 30 & # x02009nM المحتضن مع GTB25 الساخن مع C80 (i) البارد ، تنافس C80 الساخن مع GTB25 البارد (ii) ، تنافس GTB25 الساخن مع GTB25 البارد (iii) ، و C80 الساخن تنافس C80 البارد (iv). لاحظ أن GTB25 و GTB26 عبارة عن أليغنوكليوتيدات تحتوي على DUS ، في حين أن C80 و G80 عبارة عن أوليغنوكليوتيدات ذات تسلسل عشوائي.

        DprAنانومتر يربط SSBنانومتر ولكن ليس SSBنانومتر& # x003948C في المختبر

        لتحديد ما إذا كان DprAنانومتر يتفاعل مباشرة مع SSBنانومتر، استخدمنا عمود كروماتوغرافيا لاستبعاد الحجم. عندما يكون خليط DprAنانومتر و SSBنانومتر في العمود ، ظهرت ذروة جديدة تمت التصفية منها مبكرًا (11.0 & # x02009ml) مما كانت عليه عندما تم حقن كل من البروتينين بمفرده (الشكل 6 أ). يُحقن بمفرده ، DprAنانومتر مزال في 13 & # x02009ml و SSBنانومتر تمت التصفية التتابعية عند 12.6 & # x02009 مل. هذا يشير إلى أنه في ظل الظروف المستخدمة DprAنانومتر و SSBنانومتر قادرون على تكوين معقد في المختبر، بدون إضافة DNA (الشكل 6 أ). عندما تم إجراء نفس التجربة باستخدام SSBنانومتر& # x003948C ، لم يلاحظ أي تغيير في نمط الشطف لـ DprAنانومتر، مما يشير إلى عدم حدوث تشكيل معقد يمكن اكتشافه بين DprAنانومتر و SSBنانومتر& # x003948C (الشكل 6 ب).

        DprAنانومتر يتفاعل مباشرة مع SSBنانومتر، ولكن ليس مع SSBنانومتر& # x003948C. (أ) اختبار تفاعل البروتين و # x02013 البروتين عن طريق كروماتوغرافيا استبعاد الحجم باستخدام 40 & # x02009 & # x000b5M DprAنانومتر و 80 & # x02009 & # x000b5M SSBنانومتر. اللوحة العلوية: كروماتوجرام أ280 (mAU) مقابل حجم الاحتفاظ (مل). اللوحة السفلية: SDS-PAGE من 13 & # x02009 & # x000b5l من كل 0.5 & # x02009ml جزء ملطخ باللون الأزرق Coomassie ، 80 & # x02009 & # x000b5M SSBنانومتر ممزوج بـ 40 & # x02009 & # x000b5M DprAنانومتر وكل بروتين وحده. الكسر الأول على كل هلام هو 7 إلى 7.5 & # x02009ml والجزء الأخير من 16 إلى 16.5 & # x02009ml. (ب) تجربة مماثلة لتلك الموجودة في (أ) ، ولكن مع SSBنانومتر& # x003948C بدلاً من SSBنانومتر. (ج) الرحلان الحراري المجهري (MST) لـ DprAنانومتر مع SSBنانومتر ومع SSBنانومتر& # x003948C. يتم رسم تركيز يجند على x- يتم رسم المحور وقيم الملاءمة المعيارية على ذ-محور. بالنسبة إلى DprAنانومتر& # x02013SSBنانومتر التفاعل أ كد 1458 & # x000b1544 & # x02009nM تم حسابها.

        الحالة المتعددة لـ DprAنانومتر و SSBنانومتر تمت دراستها عن طريق كروماتوغرافيا استبعاد الحجم باستخدام نظام SEC-MALS مضمن في ظل ظروف مماثلة لتلك التي كانت أثناء اختبار كروماتوغرافيا الاستبعاد المشترك الحجم.من خلال قياس تشتت الضوء أثناء شطف القمم الرئيسية ، قدر البرنامج حجم DprAنانومتر من 94 & # x0201396 & # x02009kDa وحجم SSBنانومتر من 91 & # x0201392 & # x02009kDa. هذا يتفق بشكل معقول مع DprAنانومتر تشكيل ثنائيات بحجم نظري 89.6 & # x02009kDa و SSBنانومتر تشكيل رباعيات بحجم نظري 83.4 & # x02009kDa. تم الإبلاغ عن Dimerization من DprA لـ DprASp [21] ، وتم الإبلاغ عن tetramerization من SSB ل بكتريا قولونية [68].

        بالإضافة إلى ذلك ، باستخدام MST ، التفاعل بين SSBنانومتر و DprAنانومتر تم تمييزه كذلك. معايرة بتركيزات متفاوتة من DprAنانومتر ضد SSBنانومتر أعطت بيانات متسقة مع موقع ربط واحد ومحسوب كد قيمة 1458 & # x000b1544 & # x02009nM (الشكل 6 ج). في المقابل ، فإن الجمع بين DprA المنتج بشكل متجانسنانومتر و SSBنانومتر& # x003948C لم ينتج عنه ارتباط قابل للاكتشاف (الشكل 6 ج).

        DprA يتم نسخها بالاشتراك مع smg و أعلى

        المصب على الفور من dprAنانومتر هي الجينات smg و أعلى (الشكل 6 أ). نتج smg الجين هو بروتين جديد مرتبط بالـ RNA يعمل كمنظم للترجمة في ذبابة الفاكهة سوداء البطن [69]. ومع ذلك ، فإن وظيفة smg غير معروف في البكتيريا ، بينما أعلى يشفر DNA topoisomerase I ، وهو نوع IA topoisomerase. في جينوم Nm MC58 ، dprA ، smg و أعلى تم توقعها بواسطة STRING لتشكيل أوبرا ، مع فاصل نسخ واحد على حبلا زائد 3 & # x02032 إلى أعلى (الشكل 7 أ) ، مروج واحد على الجانب 5 & # x02032 من dprA وتوقع أحد المروجين في منتصف dprA ORF. لذلك ، كان من المحتمل أن dprA يتم نسخها مع الجينات المجاورة لها. تمشيا مع هذه الملاحظة ، أنتج RT-PCR غير الكمي منتجات PCR الممتدة dprA, smg و أعلى (الشكل 7 ب) ، بينما لم تظهر تفاعلات التحكم السلبية أي منتج PCR قابل للاكتشاف بحجم مماثل (البيانات غير معروضة). ال dprA و أعلى يتم أيضًا توطين الجينات في الجينومات التمثيلية من 14 من 24 شُعًا بكتيريًا (الجدول S4). في Myxococcus xanthus، ال dprA و أعلى يتم دمج الجينات. dprA & # x02013smg تم العثور على التعريب المشترك في أخرى النيسرية الأنواع وفي بعض بيتابروتيوباكتيريا و جراثيم غاما. لكن، smg تم العثور على تقويم العظام فقط في Betaproteobacteria و جراثيم غاما، مع تمثيل في بكتريا قولونية, B. الرقيقة و ضمة الكوليرا. في الرئوية الرئوية, dprA, أعلى و smg لا تقم بتعيين نفس المنطقة الكروموسومية [70].

        تحليل RT-PCR لل النيسرية السحائية dprA كتلة الجينات. (أ) تنظيم الجينات في الكتلة الجينية. تظهر إطارات القراءة المفتوحة كسهم مفتوح. تتم الإشارة إلى المروجين المتوقعين بدوائر مملوءة ويشار إلى النهاية المتوقعة بدائرة مفتوحة. يتم عرض موضع التمهيدي المستخدم للنسخ العكسي بواسطة سهم. يتم إعطاء منتجات PCR المرقمة وفقًا للمسارات في (ب) بواسطة خطوط ، حيث يشير الماس إلى مواضع التمهيدي. الرقم ليس مقياس. (ب) صورة هلام Agarose لمنتجات RT-PCR. يتم إعطاء الأحجام الجزيئية على الجانبين. يتوافق ترقيم الحارة مع الأرقام الموجودة في (أ).


        الملخص

        تتطلب الزيادة الحالية في حدوث وشدة الأمراض المعدية تحسين فهم البيولوجيا الأساسية وملامح إصلاح الحمض النووي للميكروبات الخبيثة. في دراساتنا للعوامل الممرضة الرئيسية والكائن الحي النيسرية السحائية، قمنا ببناء لوحة من المسوخات التي تعطل الجينات المشاركة في إصلاح استئصال القاعدة ، وإصلاح عدم التطابق ، وإصلاح ختان النوكليوتيدات (NER) ، وتوليف الترانسليشن ، ومسارات الإصلاح التأشبية. أعلى تردد طفرة عفوية بين N. السحائية تم العثور على طفرات مفردة في سلالة تعاني من نقص MutY بدلاً من كتم المسوخ في الإشريكية القولونية، مما يشير إلى دور المكورات السحائية في تطوير مقاومة المضادات الحيوية. تم التعرف على الإصلاح التأشبي باعتباره مسارًا رئيسيًا يقاوم ضرر الألكلة الناجم عن ميثان سلفونات الميثيل في N. السحائية. على عكس ما تم عرضه في الأنواع الأخرى ، لم يساهم NER للمكورات السحائية بشكل كبير في إصلاح تلف الحمض النووي الناجم عن الألكلة ، وبالتالي قد يكون الإصلاح التأشبي للمكورات السحائية أحد المسارات الرئيسية لإزالة المواقع الجذابة (الأبورينية / الأبيرية) والحبل. يكسر في الحمض النووي. على العكس من ذلك ، تم تحديد NER باعتباره المسار الدفاعي الرئيسي للمكورات السحائية ضد تلف الحمض النووي الناجم عن الأشعة فوق البنفسجية. N. السحائية أظهرت طفرات RecA الفردية انخفاضًا معتدلاً في البقاء على قيد الحياة بعد التعرض للأشعة فوق البنفسجية بدلاً من الإشريكية القولونية recA سلالات حساسة للغاية للأشعة فوق البنفسجية ، ربما تعكس عدم استجابة المكورات السحائية SOS. في الختام ، اختلافات واضحة بين N. السحائية وأثبتت خصائص إصلاح الحمض النووي في بكتريا قولونية وأنواع أخرى تم تحديدها.

        النيسرية السحائية، أو المكورات السحائية (MC) ، سالبة الجرام من سكان البلعوم الفموي البشري التي قد تنتشر في مجرى الدم وتعبر الحاجز الدموي الدماغي لتسبب تسمم الدم و / أو التهاب السحايا. تتعرض خلايا MC الموجودة على الأسطح المخاطية لعوامل ضارة بالحمض النووي ، ولا سيما أنواع الأكسجين التفاعلية (ROS) الناتجة عن التمثيل الغذائي الخلوي الطبيعي أو نظام المناعة عالي الفعالية من خلال الانفجار التأكسدي. يمكن أن تؤدي أنواع الأكسجين التفاعلية من المصادر الخارجية والداخلية إلى عدد كبير من أنواع مختلفة من تلف الحمض النووي ، بما في ذلك الفواصل أحادية ومزدوجة الخيط ، والمواقع الأباسية (الأبوريني / الأبيريميدين ، أو AP) ، والأضرار الأساسية ، من بينها منتج أكسدة الجوانين ، 7،8-dihydro-8-oxo-2 & # x02032-deoxyguanosine (8oxoG) ، هي واحدة من أكثرها شيوعًا (13). تتم معالجة تلف الحمض النووي المؤكسد بشكل أساسي عن طريق مسار إصلاح الاستئصال الأساسي (BER) (52). في الإشريكية القولونية، تم إطلاق BER بواسطة glycosylases DNA التي تقضي على ن- الرابطة الجليكوزيلية وإزالة القاعدة التالفة عن طريق آلية التقليب. يتم استئصال شقوق السكر والفوسفات المتبقية لاحقًا إما عن طريق نشاط AP-lyase المتأصل في العديد من جليكوزيلات الحمض النووي أو عن طريق نوكلياز AP ​​، تاركًا معالجة المحطة 3 & # x02032 أو 5 & # x02032 ، على التوالي ، إلى deoxyribose phosphodiesterase (52) . ثلاثة من الإنزيمات المشار إليها باسم نظام GO المكون من DNA glycosylases MutY و Fpg ، بالإضافة إلى النيوكليوتيدات hydrolase MutT ، تشارك في الحد من التأثيرات الطفرية لـ 8oxoG (38).

        على عكس الأصل الداخلي لآفات BER ، فإن إصلاح ختان النوكليوتيدات (NER) يصلح بشكل عام الآفات الضخمة الناتجة عن الإجهاد من مصادر خارجية تتداخل مع الاقتران الأساسي الطبيعي وتضعف النسخ والتكرار (12). في بكتريا قولونية يتم تنفيذ NER بواسطة مركب UvrABC الذي يزيل امتداد النيوكليوتيدات بما في ذلك الآفة (12 ، 51). يتعرف المسار الثالث لإصلاح الختان ، إصلاح عدم التطابق (MMR) ، على عدم تطابق القاعدة الأساسية وحلقات الإدخال / الحذف ، بما في ذلك تلك التي أدخلتها بوليميرات الحمض النووي. في بكتريا قولونية MMR ، التعرف على عدم تطابق MutS (33 ، 43) يتبعه توظيف MutL (2). تعمل هذه الإنزيمات معًا على تنشيط MH ، وهو نوكلياز داخلي يشق بشكل تفضيلي الشريط غير الميثيل في مواقع GATC نصف الميثيل (3). إضافي بكتريا قولونية تدير مسارات إصلاح الحمض النووي فئات أخرى من آفات الحمض النووي: يتم إصلاح الفواصل المزدوجة التي تقطعت بها السبل بشكل أساسي بواسطة بكتريا قولونية إصلاح التأشيب عن طريق مسار RecABCD (32). المكون الرئيسي ، RecA ، لديه القدرة على الاقتران بشكل متجانس ، عبر تبادل حبلا ، مزدوج تالف مع شقيقة مزدوجة سليمة (32). علاوة على ذلك ، فإن ربط بكتريا قولونية ينظم RecA إلى مناطق أحادية السلسلة التعبير عن أكثر من 40 جينًا لنظام SOS محرضًا يشارك في إصلاح تلف الحمض النووي واستعادة النسخ المتماثل (18). تحمل الضرر في بكتريا قولونية يتم توفيره أيضًا من خلال إصلاح فجوة حبلا الابنة ، بالإضافة إلى توليف الترانزستور (TLS) المكون من بوليميرات الحمض النووي TLS الثلاثة Pol II (8) و DinB (58) و UmuDC & # x02032 (56) التي تسمح بالنسخ المتماثل لآفات الحجب في تكلفة الطفرات (40).

        تم اشتقاق البيانات المتاحة عن مكونات إصلاح MC DNA بشكل أساسي من تسلسل الجينوم والتجارب التي أجريت في أقرباء ، النيسرية البنية (المكورات البنية) (11 ، 29). المكون الوحيد لإصلاح DNA MC المميز بالكامل حتى الآن هو BER DNA glycosylase MutY (10). تم تحديد متماثلات MC للمكونات الأخرى لمسار BER ، ومع ذلك ، فإن الجينات التي ترمز DNA glycosylase Nei و Endonuclease Nfo مفقودة (29). تم تحديد مسار MC NER وظيفي واضح أيضًا منذ أن تأوي جينومات MC متجانسات الأشعة فوق البنفسجية, الأشعة فوق البنفسجية، و uvrC الجينات (46 ، 57) ، ونشاط NER للمكورات البنية تم تأكيده تجريبياً (4). بالإضافة إلى ذلك ، تكشف جينومات MC عن وجود MMR كتم (الفئة الأولى) و mutL المتجانسات ، بينما mutH و سد المتماثلات مفقودة (46 ، 49 ، 57). نظرًا لتكرار حدوث إعادة التركيب ، والتحول ، والاختلاف المستضدي ، فإن بروتينات الإصلاح المؤتلف ، بما في ذلك RecA ، هي الأكثر أهمية في العوامل الممرضة. النيسرية (11 ، 31). على الرغم من أن أ recF المتماثل مفقود ، كل من المسارات الشبيهة بـ RecBCD و RecF متورطة في إصلاح الحمض النووي (37) ، وتعمل المكورات البنية RecA في كلا المسارين (30 ، 37). في المقابل ، لم يتم اكتشاف متماثل LexA ولا صناديق SOS في جينومات MC أو المكورات البنية ، وتم تأكيد عدم وجود استجابة SOS محرضة في المكورات البنية تجريبياً (5). بالإضافة إلى ذلك ، أظهرت عمليات البحث عن التماثل أن جينومات MC تحتوي فقط على جين بوليميريز DNA TLS واحد يشفر متماثل DinB (11 ، 35).

        ترتبط العدوى التي تسببها MC بمراضة ووفيات كبيرة في جميع أنحاء العالم. ومع ذلك ، توجد معلومات محدودة للغاية حول إصلاح الحمض النووي MC وتأثيره على عدم استقرار الجينوم ، وتنوع الإجهاد ، والتسبب في المرض (11). في هذه الدراسة ، قمنا بالتحقيق في التفاعلات المحتملة لـ BER مع مسارات إصلاح الحمض النووي الأخرى. قمنا ببناء لوحة من طفرات MC لتعطيل التعبير عن مكونات BER المحددة ونشاط MMR و NER والإصلاح التأشبي و TLS ، بمفردها أو بالاشتراك مع BER. تم تقييم طفرات إصلاح الحمض النووي الفردية والمزدوجة فيما يتعلق بالطفرة التلقائية ومعدلات التحول ، وكذلك البقاء على قيد الحياة بعد التعرض للعديد من العوامل الضارة بالحمض النووي. تشير نتائجنا إلى أن التفاعلات بين مسارات إصلاح DNA MC تختلف اختلافًا كبيرًا عما تم توثيقه سابقًا فيه بكتريا قولونية وأنواع أخرى.


        تحول النيسرية السحائية إلى مسببات الأمراض - علم الأحياء

        في هذا الكتاب الرائد النيسرية تستعرض السلطات أهم الأبحاث حول مسببات الأمراض النيسرية لتقديم لمحة عامة عن الميدان في الوقت المناسب. تشمل الموضوعات التي يتم تناولها: الارتباط بين التسبب في المرض والمسارات الأيضية المهمة لتطوير اللقاح ، ونسخ مقاومة المضادات الحيوية للشبكات التنظيمية لتفاعلات الحمض النووي الريبي الصغيرة مع العدلات والتقدم في نماذج الفئران المتوافقة مع البشر. دليل أساسي لعلماء الأبحاث والطلاب المتقدمين والأطباء وغيرهم من المهنيين العاملين معهم النيسرية، هذا الكتاب هو نص موصى به لجميع مكتبات علم الأحياء الدقيقة.

        "نظرة عامة حالية على أهم البحوث في هذا المجال." من رينجولد (فبراير 2015).

        "تستعرض سلطات Neisseria الرائدة الأبحاث الحديثة حول Neisseria المسببة للأمراض لتقديم نظرة عامة في الوقت المناسب عن هذا المجال. (موصى به) لعلماء الأبحاث والطلاب المتقدمين والأطباء وغيرهم من المهنيين العاملين مع Neisseria." من التنوع الفطري

        (EAN: 9781908230478 9781908230614 الموضوعات: [علم الأحياء الدقيقة] [علم الجراثيم] [علم الأحياء الدقيقة الطبية] [علم الأحياء الدقيقة الجزيئي] [علم الجينوم])


        النيسرية السحائية

        N. السحائية (المكورات السحائية) هي بكتيريا سالبة الجرام ، وعامل مسبب رئيسي لالتهاب السحايا الجرثومي والإنتان الشديد. تعد عدوى المكورات السحائية سببًا رئيسيًا للمراضة والوفيات في جميع أنحاء العالم ، وبالتالي فإن فهم البيولوجيا الجزيئية أمر بالغ الأهمية لتطوير علاجات مثل اللقاحات.

        سيصاب 1 من كل 100000 شخص بالعدوى التهاب السحايا بالنيسرية كل عام ، مع معدل مذهل للأطفال دون سن واحد يبلغ 30 حالة لكل 100،000. N. السحائية يمكن إجراء نمذجة مصلية بناءً على تشابه الكبسولات. هناك خمس مجموعات مصلية من N. السحائية يشيع استعمار البلعوم الأنفي البشري ، وهذه هي: الأنواع A و C و W و Y و B. يختلف توزيع هذه المجموعات المصلية وحملها في السكان بمرور الوقت ، وفهم هذا التوزيع مهم لإعلام برامج التطعيم ضد المكورات السحائية. تعتبر سلالات المجموعة المصلية B مقلقة بشكل خاص عند الأطفال ، وهي واحدة من أعلى أسباب الوفيات في هذه الفئة العمرية.

        مسح صورة المجهر الإلكتروني للـ Nmeningitidis

        تُظهر هذه الصورة الأزواج المميزة لخلايا N. meninigitidis التي تشكل مكورة ثنائية.

        N. السحائية عادة ما يستعمر البلعوم الأنفي لحوالي 10 ٪ من الأفراد الأصحاء ، ولكن يمكن أن يستمر في التسبب في التهاب السحايا إذا أصابوا الأغشية الواقية المعقمة حول الدماغ والحبل الشوكي (السحايا) أو تسمم الدم إذا وجدوا طريقهم إلى الدم. تشمل أعراض التهاب السحايا بالمكورات السحائية على وجه التحديد: التعب والحمى والصداع ولكن يمكن أن تتطور بسرعة إلى تصلب الرقبة والغيبوبة والموت. التهاب السحايا بالمكورات السحائية هو الشكل الوحيد للمرض المعروف أنه ينتقل بشكل وبائي ، عادة في إفريقيا وجنوب شرق آسيا. وينتشر عن طريق السعال والعطس وطرد إفرازات الجهاز التنفسي الأخرى.

        N.meningitidis لها العديد من العوامل المختلفة التي تساهم في قدرتها على التسبب في المرض. وتشمل هذه مكونات عديد السكاريد الدهني للغشاء الخارجي ، والذي يعمل كسموم ضد خلايا الدم الحمراء (السبب الرئيسي لصدمة إنتانية ونزيف). يمكنك العثور على مراجعة مفيدة للعديد من الآليات الجزيئية التي تساهم في الإمراضية النيسرية السحائية هنا.

        هنا في UoL نحن مهتمون بعلم الوراثة النيسرية السحائية، وعلى وجه الخصوص الطريقة التي يمكن بها تبديل التعبير عن بعض جيناتها تشغيل و إيقاف، وهي ظاهرة تعرف باسم تباين الطور. تسمح هذه العملية للبكتيريا بتوليد التنوع بسرعة استجابة للبيئة المعادية للمضيف البشري. انقر هنا لقراءة المزيد عن تباين المرحلة وتناول برنامجنا التعليمي الذي يبحث في مساهمة تباين الطور في سبب المرض N. السحائية.

        النيسرية السحائية-
        • العامل المسبب الرئيسي لالتهاب السحايا الجرثومي.
        • عوامل الضراوة الرئيسية تشمل التصاقات السطحية Opa و Opc ، والبروتياز IgA.


        الفصل 10: تفاعل البوليميراز المتسلسل للكشف عن مسببات التهاب السحايا الجرثومي وتوصيفها: النيسرية السحائية, المستدمية النزلية، و العقدية الرئوية

        1. نظرة عامة على تقنيات تفاعل البوليميراز المتسلسل (PCR) في البلدان النامية ، تشتمل الأساليب الأكثر استخدامًا للكشف عن مسببات التهاب السحايا الجرثومي وتوصيفها على الثقافة ، وصبغة غرام ، وتراص اللاتكس. على الرغم من أن الثقافة تعتبر المعيار الذهبي لتأكيد الحالة في العيادات ، إلا أن المعدل الإيجابي منخفض نسبيًا بسبب ظروف التخزين والنقل دون المستوى الأمثل ، وممارسة الاستزراع ، و / أو العلاج بالمضادات الحيوية قبل جمع العينة. في حين أن تلطيخ الجرام مهم وغير مكلف ويجب إجراؤه كلما أمكن ذلك ، فإنه يعطي فقط فكرة عن جنس وأنواع العامل المسبب للمرض. تعتبر قراءة نتائج تراص اللاتكس ذاتية ويمكن أن يكون من الصعب تفسيرها ، خاصة عندما يكون الحمل البكتيري للعينة و rsquos منخفضًا. كما أنه ليس من المجدي إجراء مراقبة الجودة على تراص اللاتكس. يجب الحفاظ على الثقافة كمعيار ذهبي لأن البكتيريا المستزرعة هي مصادر للبيانات عن قابلية المضادات الحيوية ، والتصنيف الفرعي الكامل ، والتعبير عن المستضدات التي سيتم تضمينها في اللقاحات المستقبلية ، والفيزيولوجيا المرضية للعزلات. لا يزال من الممكن تحليل العينات التي لا تنتج أي ثقافة بالطرق الجزيئية (انظر أدناه) التي يمكن تطبيقها على الحمض النووي المستخرج من العينات السريرية (عادةً الدم و CSF).
          1. تم تطوير تفاعل البوليميراز المتسلسل (PCR) PCR في منتصف إلى أواخر الثمانينيات (36 ، 42) ويعتبر أحد أهم الاختراعات المنهجية في البيولوجيا الجزيئية. تم تصميمه للسماح بالتضخيم الانتقائي لتسلسل (تسلسلات) الحمض النووي المستهدفة المحددة ضمن مجموعة غير متجانسة من تسلسلات الحمض النووي (على سبيل المثال ، الحمض النووي الجيني الكلي). في تفاعل البوليميراز المتسلسل ، يتم تضخيم هدف الحمض النووي بشكل كبير من خلال تكرار ثلاث خطوات رئيسية: 1) تمسخ الحمض النووي المزدوج الجديلة إلى الحمض النووي أحادي الجديلة 2) تلدين البادئات إلى التسلسلات المستهدفة التكميلية أحادية السلسلة و 3) تمديد الاشعال في 5 & ​​رئيس إلى 3 & اتجاه رئيسي بواسطة بوليميراز الحمض النووي المستقر للحرارة لإنتاج جزيئات DNA مزدوجة تقطعت بهم السبل. يتضاعف عدد نسخ جزيئات الحمض النووي في كل خطوة تمديد ، مما ينتج ملايين النسخ من جزيئات الحمض النووي الأصلية عند اكتمال PCR. نظرًا لأن الطريقة لا تتطلب خلايا حية أو سليمة ، فإن تفاعل البوليميراز المتسلسل هو أداة قيمة للكشف عن العوامل المسببة للأمراض البكتيرية من العينات السريرية ، حيث تموت البكتيريا أو تتلاشى بسهولة بسبب ظروف التخزين غير المناسبة أو العلاج السابق بالمضادات الحيوية. يستخدم تفاعل البوليميراز المتسلسل (PCR) الآن على نطاق واسع في تشخيص ومراقبة مسببات الأمراض البكتيرية بسبب حساسيته العالية وخصوصيته وقدراته الإنتاجية العالية. يوفر أداة تكميلية للطرق التقليدية القائمة على النمط الظاهري مثل الثقافة ، وصمة الجرام ، وتراص اللاتكس ، وغالبًا ما يعزز النتائج المؤكدة (3). تم تطوير عدد من فحوصات PCR التقليدية للكشف عن مسببات الأمراض البكتيرية والفيروسية وتصنيفها. يكتشف تفاعل البوليميراز المتسلسل (PCR) التقليدي المنتجات في نقطة نهاية تضخيم الحمض النووي عن طريق تصور الأمبليكون باستخدام الرحلان الكهربائي للهلام الاغاروز. يتطلب الاكتشاف المعتمد على الهلام فتح الأنابيب التي تحتوي على أمبليكونات PCR ومعالجتها ، مما يزيد بشكل كبير من خطر تلوث مساحة المختبر ، والمعدات ، والكواشف بمواد مضخمة.كما أن تفاعل البوليميراز المتسلسل التقليدي يستغرق وقتًا طويلاً جدًا وأقل حساسية وتحديدًا من نوع PCR يسمى تفاعل البوليميراز المتسلسل في الوقت الحقيقي ، لذلك فهو يستخدم بشكل أساسي في كتابة المقايسات التي تستخدم ثقافات نقية أو عينات إكلينيكية تحتوي على الكائن الحي بكثافة عالية. يتوسع استخدام تفاعل البوليميراز المتسلسل في الوقت الحقيقي بشكل سريع لأنه أسهل في الأداء ، ولأنه نظام مغلق ، فإنه يقلل من مشاكل التلوث المحتملة الكامنة في تفاعل البوليميراز المتسلسل التقليدي. العديد من نفس الاحتياطات المذكورة لفحوصات PCR التقليدية تنطبق أيضًا على مقايسات PCR في الوقت الحقيقي.
          2. تقنية تفاعل البوليميراز المتسلسل في الوقت الحقيقي تُعرف تقنية تفاعل البوليميراز المتسلسل في الوقت الفعلي أيضًا باسم تفاعل البلمرة المتسلسل الكمي في الوقت الفعلي (Q-PCR / qPCR) أو تفاعل البوليميراز الحركي المتسلسل ، والذي يجمع بين التضخيم والكشف في خطوة واحدة من خلال استخدام الأصباغ الفلورية. هناك نوعان من أنظمة الكشف: غير محددة ومحددة. تستخدم أنظمة الكشف غير المحددة صبغة الفلورسنت التي تتداخل في أي جزيئات DNA مزدوجة الشريطة وتنبعث من الفلورة المحسنة. نظام الكشف هذا غير مكلف نسبيًا ولكنه عرضة للإيجابية الزائفة. تعتمد أنظمة الكشف المحددة على مجسات نقل طاقة الرنين الفلوري التي تتعرف بشكل خاص على تسلسل الهدف ، مما يجعلها الأنظمة المختارة لفحوصات الكشف الجزيئي الموصوفة هنا. تعد أنظمة الكشف المحددة أكثر تكلفة من أنظمة الكشف غير المحددة وتتطلب تصميمات مسبار متطورة. يتم استخدام ثلاثة أنواع من المجسات حاليًا ، بما في ذلك: التحلل المائي ، والتهجين ، وتحقيقات دبوس الشعر (7 ، 13). يتم إنشاء إشارة الفلورسنت فقط إذا كان المسبار يتفاعل مع هدفه المحدد ثم يتحلل لاحقًا أثناء التضخيم. تتناسب الزيادة الناتجة في التألق مع كمية منتج PCR المتضخم في التفاعل. تم الإبلاغ عن أول استخدام لمجسات التحلل المائي المزدوجة في عام 1993 (30) وقد تم استخدامها على نطاق واسع في العديد من المختبرات منذ ذلك الوقت. مسبار التحلل المائي المزدوج عبارة عن أليغنوكليوتيد (

          الشكل 1. كيمياء مسبار التحلل المائي المزدوج المسمى. عرض أيقونة الصورة بشكل أكبر

            فحص PCR في الوقت الحقيقي الخاص بالأنواع الخاصة بكشف PCR لـ النيسرية السحائية ، المستدمية النزلية ، و الرئوية الرئوية يمكن تحقيقه عن طريق تضخيم عدة أهداف جينية محتملة (8 ، 35 ، 53 ، 60). تم تطوير الاختبارات التالية والتحقق من صحتها لاستخدامها في الحمض النووي المستخرج من العينات السريرية (عادةً ، الدم و CSF) والعزلات البكتيرية.
          N. السحائية

          يمكن استهداف جينين في N. السحائية المقايسات الخاصة بالأنواع ، ctrA و sodc. نقل الكبسولة إلى جين سطح الخلية ، ctrA ، يتم حفظه بشكل كبير بين العزلات المسؤولة عن عدوى المكورات السحائية الغازية وقد تم استخدامه في كل من الوقت الحقيقي وتقليدي PCR للكشف عن N. السحائية (35). إنه جين داخل موضع الكبسولة (الشكل 2). ومع ذلك ، منذ ما لا يقل عن 16 ٪ من المكورات السحائية المحمولة تفتقر ctrA (10 ، 14 ، 41) ، تم مؤخرًا تطوير والتحقق من صحة اختبار PCR في الوقت الحقيقي للكشف عن جميع المكورات السحائية ، بغض النظر عن حالة التغليف (15). يستهدف هذا الاختبار جين ديسموتاز النحاس والزنك الفائق ، sodc، والتي لا ترتبط وراثيا بموضع الكبسولة. ال sodc يكتشف الفحص المكورات السحائية المغلفة ، ولكنه مفيد أيضًا للكشف عن المكورات السحائية غير القابلة للتجميع والتي لا تحتوي على مادة سليمة ctrA، كما سيتم استردادها أثناء دراسات النقل. لهذا السبب ، فمن المستحسن أن sodc تستخدم للكشف عن N. السحائية، اذا كان ممكنا. sodc و ctrA يتم سرد الاشعال والتحقيقات في الجدول 2.

          المستدمية النزلية

          الجين المشفر للبروتين D ، حصان، يشفر البروتين D ، وهو بروتين دهني شديد الحفظ ومعرض للسطح وموجود في جميع المغلفات وغير المغلفة المستدمية النزلية (24 ، 45). الطبيعة المحفوظة لهذا الجين ووجوده في جميع سلالات المستدمية النزلية تتميز حتى الآن بجعلها هدفًا جينيًا جذابًا للغاية لتطوير a المستدمية النزلية فحص PCR في الوقت الحقيقي الخاص بالأنواع. تم تطويره مؤخرًا والتحقق من صحته حصان اختبار PCR في الوقت الحقيقي قادر على اكتشاف جميع الأنماط المصلية الستة (a-f) وغير القابلة للنمط (HiNT) المستدمية النزلية ذات حساسية وخصوصية عالية (60). استهداف فحوصات PCR في الوقت الحقيقي bexA تم تطويرها وتوزيعها لأن bexA موجود في جميع الأنماط المصلية الستة المستدمية النزلية. ومع ذلك ، على الرغم من أنها حساسة للكشف عن Hib ، إلا أنها أقل حساسية لـ Hia و Hic و Hid ، ولا تكتشف Hie أو Hif أو HiNT ويجب عدم استخدامها بعد الآن. التمهيديات والتحقيقات الخاصة بـ حصان المقايسة مدرجة في الجدول 2.

          الرئوية الرئوية

          تم تطوير فحوصات PCR التقليدية وفي الوقت الحقيقي للكشف عن الرئوية الرئوية ، والجينات المستهدفة شملت pneumolysin (رقائق) ، autolysin (ليتا) ، والتصاق سطح المكورات الرئوية (psaA) الجينات (8). ومع ذلك ، نتائج إيجابية كاذبة مع رقائقتم الإبلاغ عن تفاعل البوليميراز المتسلسل القائم على تفاعل البوليميراز المتسلسل عند استخدامه على عينات الجهاز التنفسي العلوي. التفسير المقترح لهذه الإيجابيات الكاذبة هو اكتشاف المكورات العقدية الانحلالية ألفا غير المكورات الرئوية (37 ، 47) ، والتي توجد عادة في النباتات التنفسية (على سبيل المثال ، التهاب المكورات العقدية المجموعة و العقدية الفموية) والتي تحتوي أحيانًا على ملف رقائق جين (62). مقايسة الكشف عن PCR لـ الرئوية الرئوية باستخدام جزء معين من جين autolysin (ليتأ) يوصى به لأنه محفوظ بدرجة عالية داخل الأنواع وقد ثبت أن هذا الفحص يفصل بشكل أفضل الرئوية الرئوية من الأنواع المماثلة وراثيًا S. ميتيس ، S. Oralis ، و S. pseudopneumoniae (33). مقايسة PCR في الوقت الحقيقي ليتا البادئات والتحقيقات التي تم العثور عليها لتكون موثوقة للغاية للكشف عن الرئوية الرئوية المدرجة في الجدول 2. بسبب أحداث إعادة التركيب التي تحدث بين المكورات الرئوية والمكورات العقدية وثيقة الصلة ، سيكون هناك على الأرجح إيجابيات كاذبة أو سلبيات كاذبة نادرة لأي فحص في الوقت الحقيقي لتحديد المكورات الرئوية.

          N. السحائية

          N. السحائية يتم تصنيفها إلى 12 مجموعة مصلية على أساس التركيب الكيميائي ونوع الارتباط لوحدات السكريد الفرعية لعديد السكاريد المحفظي التي يتم التعبير عنها على سطح الخلية البكتيرية. تشمل المجموعات المصلية الرئيسية المسببة للأمراض A و B و C و Y و W135 ، والأربعة الأخيرة منها تنتج حمض السياليك الذي يحتوي على عديد السكاريد المحفظي بينما تنتج المجموعة المصلية A كبسولة N-acetylmannosamine 6-phosphate مرتبطة بـ poly- & alpha1-6 (31) . تم الإبلاغ أيضًا عن تفشي المرض الناجم عن المكورات السحائية من المجموعة المصلية X ، والتي تعبر عن كبسولة N-acetylglucosamine 1-phosphate المرتبطة بالبولي وألفا 1-4 (6) (2 ، 20). لم يعد يتم التعرف على مجموعة Serogroup D كمجموعة مصلية لـ N. السحائية.

          كما هو موضح في الشكل 2 ، يتم حفظ التنظيم الجيني لموضع الكبسولة بين المجموعات المصلية. توجد جينات تعبير الكبسولة في أربعة عوامل: واحد يشفر التركيب الحيوي للكبسولة (يسمى مزامنة أو سيا الجينات ، اعتمادًا على نظام التسمية المستخدم) وثلاثة تشفر نقل الكبسولة إلى بروتينات سطح الخلية (السيطرة). المنتجات الجينية من السيطرة يشترك الأوبون في تشابه كبير مع الناقلات المعتمدة على ATP لعائلة ABC (19) ويتم الحفاظ عليها بشكل كبير بين المجموعات المصلية الرئيسية المسببة للأمراض (1 ، 18 ، 39 ، 55) والمجموعة المصلية X (56). استهداف فحوصات PCR في الوقت الحقيقي الحساسة ctrA، وهو الجين الأول في مشغل نقل الكبسولة ، وقد تم تطويره للكشف عن جميع الكبسولات المغلفة وبعضها غير المغلف (غير قابل للتجميع) N. السحائية (12 ، 35) ، على الرغم من إجراء اختبار أكثر تحديدًا وحساسية باستخدام sodc تم تطوير الجين كهدف. سهلت الاختلافات الوراثية بين عوامل التركيب الحيوي للكبسولة للمجموعات المصلية للمكورات السحائية تطوير فحوصات PCR في الوقت الحقيقي التي تستهدف الجينات الخاصة بالمجموعة المصلية للتخليق الحيوي للكبسولة لتحديد النمط الجيني للكبسولة لعزل المكورات السحائية (35).

          الجين سيا (للتخليق الحيوي لحمض السياليك (16 ، 22) ، ويسمى أيضًا مزامنة التخليق الحيوي للكبسولة (21 ، 51) ، تستخدم في التنميط الجيني للمجموعات المصلية B (التزامن) ، ج (مزامنة) ، ص (التزامن) و W135 (سينج). ال سايب الجين مستهدف للمجموعة المصلية A و xcbA الجين ، الذي يشفر على الأرجح كبسولة بوليميراز ، يستهدف المجموعة المصلية X (2 ، 35). تم تصوير هذه الجينات المستهدفة داخل بنية مجمع الجينات الكبسولة للمجموعات المصلية A و B و C و Y و W135 و X (الشكل 2). يتم سرد أحدث متواليات التمهيدي والمسبار المعدلة لمقايسات PCR في الوقت الحقيقي للتجميع المصلي في الجدول 3 ، على الرغم من أنه ، بشكل دوري ، يتم تكييف الاشعال والتحقيقات كمعلومات جديدة بشأن كيمياء المسبار والتغيرات الأليلية المتاحة.

          كانت هناك عدة أنظمة مختلفة لتسمية الجينات للتخليق الحيوي لكبسولة المكورات السحائية. بعض المجموعات تسمي هذا الاوبرون مزامنة لبيو كبسولةمزامنةأطروحة (21 ، 51) استخدمت مجموعات أخرى سيا تسمية ل سياالتخليق الحيوي لحمض الرخصة (16 ، 22) لا يزال البعض الآخر يشير إليهم على أنهم جديد الجينات على أساس التماثل إلى بكتريا قولونية الجينات K1 لـ ن- أسيتيلجديدتخليق حمض الرامينيك الحيوي (21). بينما ال siaD كان يُعتقد في البداية أن جينات المجموعات المصلية B و C و W135 و Y هي أليلات ، أظهر تحليل التسلسل الأكثر شمولاً أن هذا ليس كذلك. ال التزامن و مزامنة جينات المجموعات المصلية B و C ، على التوالي ، هي الأليلات وترمز البوليميراز متعدد السكاريد المحفظي الذي يحفز الروابط المختلفة لمونومرات حمض السياليك (وربط alpha2 و rarr8 لربط المجموعة المصلية B و & alpha2 & rarr9 للمجموعة المصلية C). ومع ذلك ، فإن جينات Y و W135 يزيد حجمها عن ضعف حجم الجينات B و C وتختلف في تسلسل النوكليوتيدات (11 ، 50) ، على الرغم من أنها متشابهة للغاية مع بعضها البعض. بالإضافة إلى ذلك ، فإن البوليميرات الخاصة بالمجموعات المصلية Y و W135 تربط البوليمرات غير المتجانسة لحمض السياليك بالإضافة إلى الجلوكوز أو الجالاكتوز ، على التوالي. وهكذا ، فإن جينات بوليميراز عديد السكاريد من المجموعات المصلية Y و W135 هي الأليلات. للاستمرار في استدعاء كل جينات البوليميراز هذه siaD سيكون تسمية خاطئة. لهذه الأسباب ولأغراض التبسيط ، سيستخدم هذا النص الامتداد سينابكد/ه/F/جي المصطلحات المذكورة أعلاه وفي الجدول الأول.

          الجدول 1. نوع كبسولة المجموعة المصلية والأهداف الجينية للتنميط الجيني في الوقت الحقيقي لفحوصات تفاعل البوليميراز المتسلسل

          الجدول 1. نوع كبسولة المجموعة المصلية والأهداف الجينية للتنميط الجيني في الوقت الحقيقي لفحوصات تفاعل البوليميراز المتسلسل
          مجموعة Sero نوع الكبسولة اسم الهدف الجيني أسماء الجينات البديلة المرجع
          أ (& alpha1 & rarr6) -N-acetyl-D-mannosamine-1-phosphate سايب (31)
          ب (& alpha2 & rarr8) - حمض N-acetylneuraminic التزامن siaD
          siaD
          من ب
          siaDب
          (5, 9, 23, 48, 61)
          ج (& alpha2 & rarr9) - حمض N-acetylneuraminic مزامنة siaD من C.
          siaDج
          (5, 9, 50, 58, 61)
          W135 6-D-Gal (& alpha1 & rarr4) -N-acetylneuraminic acid (& alpha2 & rarr6) سينج siaD من W135
          siaDدبليو
          (4, 9, 14, 35, 49, 61)
          X (& alpha1 & rarr4) -ن-اسيتيل د-جلوكوزامين -1 فوسفات xcbB (2, 6)
          ص 6-D-Glc (& alpha1 & rarr4) -N-acetylneuraminic acid (& alpha2 & rarr6) التزامن siaD ذ
          siaDص
          (4, 9, 14, 35, 49, 61)

          بالنسبة للمجموعات المصلية B و C و Y و W135 ، فإن الجينات الثلاثة الأولى من مزامنة وظائف ترميز أوبرون لتخليق سلائف عديد السكاريد الكبسولة (32 ، 48 ، 51). منتج الجين الرابع هو بوليميراز يحفز تكوين البوليمرات مع الارتباط الخاص بالمجموعة المصلية. في المجموعات المصلية B و C ، تكون نواتج عامل تشغيل من أربعة جينات (سينابك بالإضافة إلى الجين polysialyltransferase التزامن [نمين ب] أو مزامنة [Nmen C]) مسؤولة عن التخليق الحيوي لحمض السياليك (المعروف أيضًا باسم ن-حمض أسيتيل نيورامينيك أو نيوناك أو نانا) البوليمر المتجانس. التعبير عن بولين- يتطلب بوليمر كبسولة أسيتيل ماموزامين -1 فوسفات من المجموعة المصلية أ sacABCD أوبرون (المعروف سابقًا باسم mynABCD (49) ، بينما التعبير عن بولي-نتتطلب كبسولة أسيتيل د-جلوكوزامين -1 فوسفات من المجموعة المصلية X xcbABC أوبرون.

          الشكل 2. الخرائط الجينية للمركب الجيني للكبسولة (cps) من N. السحائية (مقتبس من (14)). ال ctrABCD يقوم المشغل بترميز بروتينات التصدير المعتمدة على ATP (نمط الشبكة). سينابك (رمادي صلب) د/ه/F/جي (منقط)، sacABCD (مخطط أفقي) ، و xcbABC (متقطعًا قطريًا صاعدًا) ، يشفر الإنزيمات الخاصة بالمجموعة المصلية للتخليق الحيوي للبوليمر في الكبسولة. الشوفان ج (المجموعة المصلية C) و الشوفان (المجموعات المصلية W135 و Y) ، يتم نسخها بالاشتراك مع مزامنة أوبيرونات وترميز O-acetyltransferases (9). الشفاه و شفة ب رمز للبروتينات التي تم اقتراحها في الأصل لإضافة مجموعة تثبيت الفسفوليبيد على نهاية الحد من السكاريد قبل النقل (19). السيطرة و ctrF (طوب قطري) ، المعروف سابقًا باسم الشفاه و شفة ب، على التوالي ، تشارك في نقل الكبسولة (57). كان يُعتقد في السابق أن هذه المنتجات الجينية متورطة في تعديل ما بعد البلمرة. العديد من المكورات السحائية غير القابلة للتجميع والمحمولة تفتقر إلى كل أو جزء من موضع الكبسولة (10 ، 14) أولئك الذين يفتقرون إلى الموضع بأكمله لديهم تكوين جيني في هذا الموضع مثل تلك الموجودة في N. gonorrhoeae و ن. لاكتاميكا، والتي لا يعرف عنها تصنيع الكبسولة. عرض أيقونة الصورة بشكل أكبر

          المستدمية النزلية

          موضع الكبسولة لجميع الأنماط المصلية الستة لـ المستدمية النزلية (مرحبًا أ ، ب ، ج ، د ، هـ ، و) يتكون من ثلاث وظائف ترميز مناطق لتركيب عديد السكاريد ، وتعديله ، وانتقاله (الشكلان 3 و 4) (25 ، 43 ، 44). bexDCBA في رمز منطقة التصدير الذي يحركه ATP (المعروف أيضًا باسم المنطقة الأولى) لمكونات البروتين لجهاز تصدير السكاريد الذي يحركه ATP. hcsA و hcsB في منطقة تعديل ما بعد البلمرة (المعروفة أيضًا باسم المنطقة الثالثة) تشترك في تشابه كبير مع الشفاه و شفة ب (تمت إعادة تسميته مؤخرًا السيطرة و ctrF) ، على التوالي ، التي تشارك في تعديل وتصدير السكاريد كبسولة المكورات السحائية (43). كلتا المنطقتين مشتركتان في جميع الأنماط المصلية. يتم استخدام نفس التسمية للجينات في المنطقتين لجميع الأنماط المصلية الستة. تحتوي المنطقة الخاصة بالنمط المصلي (المنطقة الثانية سابقًا) على جينات لتخليق الكبسولة وهي فريدة لكل نمط مصلي. يتم تسمية الجينات الخاصة بالنمط المصلي أكس, bcs، وما إلى ذلك لتوليف الكبسولة ldquoa و rdquo ، وتوليف الكبسولة ldquob و rdquo ، وما إلى ذلك.

          ال قبعة وظائف ترميز locus لـ المستدمية النزلية تخليق الكبسولة. التنظيم الجيني لل قبعة تم وصف الموضع بشكل جيد في Hib و Hif ، اللذين ينتميان إلى قسمين نسبيين يتم تحديدهما بواسطة الكتابة الكهربية للإنزيم متعدد التركيز. تشمل منطقة التصدير التي تحركها ATP معظم سلالات Hia و Hib وجميع سلالات Hic و Hid و Hie. سلالات من هذه المنطقة اكتملت واحدة على الأقل قبعة موضع محاط بعنصر تسلسل الإدراج (IS)1016، باستثناء مرحبًا. غالبية سلالات Hib وبعض سلالات Hia من هذه المنطقة لها تكوين التكرار المباشر مع النسخة الثانية من bexA تم حذف الجين جزئيًا كما هو موضح في الشكل 4. المقتطع قبعة الموضع غير مطلوب لتخليق الكبسولة (26 & ndash28). في سلالات Hif و Hib و Hia من منطقة النمط المصلي المحددة وبعض سلالات Hie من منطقة التصدير التي تحركها ATP ، قبعة يحيط بالموضع sodc و HI1637 (26 ، 44).

          بينما يسبب النمط المصلي ب الغالبية العظمى من المستدمية النزلية المرض في البلدان التي لا يوجد بها برنامج لقاح Hib والأنماط المصلية a و c و d و e و f وغير قابلة للنمط المستدمية النزلية (NTHi) ، تساهم أيضًا في أرقام الحالات (43 ، 59). نظرًا لانتشار استخدام لقاح المستدمية النزلية من النوع ب ، فمن المهم مراقبة العينات الواردة لكل من الأنماط المصلية b و non-b من المستدمية النزلية. لذلك ، تم تطوير فحوصات PCR في الوقت الحقيقي الخاصة بالنمط المصلي والتي تستهدف جينات المنطقة الخاصة بالنمط المصلي حيثما أمكن ذلك ، أو النهاية 5 & الأولية من bexD، وهي أقل حفظًا بين الأنماط المصلية مقارنة بالجينات الأخرى في منطقة التصدير. الجينات المستهدفة لفحوصات PCR في الوقت الحقيقي الخاصة بكل نمط مصلي هي كما يلي: ACSB (هيا) ، bcsB (هب) ، ccsD (Hic) ، دكس (اختبأ) ، ecsH (مرحبًا) و bexD (هيف) (الشكل 3). يمكن العثور على معلومات التمهيدي والتحقيق لكل من فحوصات الأنماط المصلية هذه في الجدول 4. وقد ثبت أن كل من هذه المقايسات محددة للغاية وحساسة للأنماط المصلية الخاصة بها.

          الشكل 3. موقع الكبسولة المستدمية النزلية الأنماط المصلية a و b و c و d و e و f ، بما في ذلك الجينات المستهدفة لفحوصات PCR في الوقت الحقيقي الخاصة بالنمط المصلي. موضع الكبسولة لجميع الأنماط المصلية الستة لـ المستدمية النزلية (Hia-f) يتكون من ثلاث وظائف ترميز مناطق لتخليق عديد السكاريد وتعديله وانتقاله. bexDCBA في رمز منطقة التصدير (الأسهم البيضاء) التي تحركها ATP لمكونات البروتين لجهاز تصدير السكاريد الذي يحركه ATP. hcsA و hcsB هي في منطقة تعديل ما بعد البلمرة (الأسهم الرمادية) وقد تشارك في تعديل وتصدير السكاريد الكبسولي. تحتوي المنطقة الخاصة بالنمط المصلي (الأسهم الملونة) على جينات لتخليق الكبسولة وهي فريدة لكل نمط مصلي. يتم تسمية الجينات الخاصة بالنمط المصلي أكس, bcs، وما إلى ذلك من أجل "تخليق الكبسولة" ، و "تخليق الكبسولة ب" ، وما إلى ذلك. باستثناء الفحص الخاص بالنمط المصلي Hif ، يمكن العثور على الجينات المستهدفة للمقايسات الخاصة بالنمط المصلي في هذه المنطقة ويتم تمييزها بواسطة المربعات الحمراء. عرض أيقونة الصورة بشكل أكبر

          الشكل 4. التنظيم الجيني لل قبعة مكان في Hib (مقتبس من (43)). مكرر جزئيًا قبعة يُظهر موضع Hib Hi 1007 منطقة التصدير المقتطعة التي تعتمد على ATP مع حذف 1.2 كيلوبايت بين IS1016 و bexA. عرض أيقونة الصورة بشكل أكبر

          فحوصات PCR التقليدية المتعددة من أجل التنميط المصلي الرئوية الرئوية

          تم تطوير مخطط التنميط المصلي متعدد الإرسال القائم على تفاعل البوليميراز المتسلسل (PCR) الذي يشتمل على 40 نوعًا من خصائص النمط المصلي (38). يتمتع نهج تفاعل البوليميراز المتسلسل هذا بالقدرة على تقليل الاعتماد بشكل كبير على التنميط المصلي التقليدي ويوفر إمكانية تحديد النمط المصلي للمختبرات التي تفتقر إلى الأمصال المضادة للنوع المحدد والكواشف الأخرى اللازمة للنمط المصلي التقليدي ، ومع ذلك لديها المعدات اللازمة لتضخيم الحمض النووي والرحلان الكهربي.

          يستخدم نهج تعدد الإرسال 9 تفاعلات لتحديد 40 خصوصية مصلية (الجدول 5 للبادئات ، والجداول 6 و ndash8 للمخططات ، والشكل 5 لمنتجات PCR) ولكنه يوفر أيضًا بعض المرونة التي تسمح بتغيير مجموعات الأنماط المصلية المدرجة في كل تفاعل متسلسل. يمكن تعديلها بناءً على الأنماط المصلية الأكثر انتشارًا في أي منطقة جغرافية معينة ولكنها تتطلب التحقق من الصحة لضمان عدم وجود تفاعل متقاطع بين مجموعات التمهيدي للنمط المصلي. تم تصميم ثلاثة مخططات تستند إلى انتشار النمط المصلي للمكورات الرئوية في الولايات المتحدة الأمريكية وإفريقيا وأمريكا اللاتينية (الجدولان 6 و ndash8). سيستمر تحسين هذه المخططات مع إضافة أنماط مصلية إضافية وتحديث مجموعات التمهيدي لتحسين الخصوصية والحساسية. يتم وصف أحدث الطرق في مركز السيطرة على الأمراض العقدية موقع الويب ويجب استشارته على أساس منتظم

          فحوصات PCR في الوقت الحقيقي من أجل التنميط المصلي الرئوية الرئوية

          عدد من فحوصات PCR في الوقت الحقيقي من أجل التنميط المصلي الرئوية الرئوية تم نشرها في الأدبيات ويجري تطوير أخرى (34 ، 40). يوصى بهذه الاختبارات في الوقت الحقيقي لتحديد الأنماط المصلية من العينات السريرية عندما يكون الحمض النووي موجودًا بكميات منخفضة وغير كافٍ للنمط المصلي التقليدي متعدد الإرسال PCR. الرجاء مراجعة العقدية موقع المختبر على سبيل المثال.

          • ادوات
            • أجهزة الطرد المركزي الدقيقة مع وظيفة التبريد
            • حمام مائي أو سخان كتلة جافة
            • فورتيكسير
            • الفريزر
            • ثلاجة
            • مقياس الأس الهيدروجيني
            • الرصيد
            • طبق التحريك
            • 10٪ مبيض (10: 1 ، ماء: مبيض مركز) (اجعله طازجًا أسبوعيًا)
            • 70٪ إيثانول
            • 1.5 مل من أنابيب الطرد المركزي الدقيقة (معقمة ، خالية من الدنايز ، أو درجة PCR)
            • مجموعة واحدة من المرئيات الدقيقة (1-10 ومايكرول ، 2-20 وماكرول ، 20-200 وماكرول ، و100-1000 وماكرول)
            • رؤوس فلتر معقمة مسبقًا (10 ومايكرول و 200 وماكرول و 1000 ومايكرول)
            • عازلة TE (10 ملي تريس حمض الهيدروكلوريك ، درجة الحموضة 8.0 ، 1 مم EDTA)
            • عازلة تريس (10 مم تريس حمض الهيدروكلوريك ، درجة الحموضة 8.0)
            • ليسوزيم
            • موتانوليسين
            • بروتيناز K (20 مجم / مل)
            • عازلة تحلل (4٪ SDS ، 10 مم EDTA درجة الحموضة 8.0)
            • عازلة الهضم
            • الفينول
            • كلوروفورم
            • الفينول: كلوروفورم (1: 1)
            • مجموعات استخراج الحمض النووي التجارية متاحة للثقافة والدم وسوائل الجسم
            • يتوفر مزيج PCR Master التجاري الذي يحتوي على dNTPs و DNA polymerase
            EDTA ، 0.1 م ، درجة الحموضة 8.0 (100 مل)
            1. قم بإذابة 3.7 جم EDTA في 70 مل من H2 المقطر منزوع الأيونات2O (ddH2س).
            2. ضبط الأس الهيدروجيني إلى 8.0 مع 10 M هيدروكسيد الصوديوم.
            3. أضف ddH2O إلى 100 مل.
            4. الأوتوكلاف عند 121 درجة مئوية لمدة 20 دقيقة.
            5. احفظه في درجة حرارة الغرفة.
            Tris-HCl ، 0.1 م ، درجة الحموضة 8.0
            1. قم بإذابة 1.2 جرام من قاعدة Tris في 80 مل من ddH2س.
            2. ضبط إلى درجة الحموضة 8.0 مع حمض الهيدروكلوريك المركز.
            3. خلط وإضافة ddH2O إلى 100 مل.
            4. الأوتوكلاف عند 121 درجة مئوية لمدة 20 دقيقة.
            5. احفظه في درجة حرارة الغرفة.
            تريس- حمض الهيدروكلوريك ، 0.1 م ، ودرجة الحموضة 7.6
            1. قم بإذابة 1.2 جرام من قاعدة Tris في 80 مل من ddH2س.
            2. ضبط إلى 7.6 درجة الحموضة مع حمض الهيدروكلوريك المركز.
            3. خلط وإضافة ddH2O إلى 100 مل.
            4. الأوتوكلاف عند 121 درجة مئوية لمدة 20 دقيقة.
            5. احفظه في درجة حرارة الغرفة.
            20٪ كبريتات دوديسيل الصوديوم (SDS) *
            1. قم بإذابة 20 جم SDS في 100 مل من ddH المعقم2س.
            2. ضع الحاوية في حمام مائي 50-607 درجة مئوية لتسهيل الذوبان.
            3. تجنب الاهتزاز الشديد الذي يولد الفقاعات.
            4. احفظه في درجة حرارة الغرفة.

            * يجب ارتداء حماية العين والجهاز التنفسي عند وزن مسحوق SDS.

            عازلة TE (10 مم تريس حمض الهيدروكلوريك ، درجة الحموضة 8.0 ، 1 مم EDTA)
            1. أضف 10 مل من 0.1 M Tris-HCl ، ودرجة الحموضة 8.0.
            2. أضف 1 مل من 0.1 M EDTA ، درجة الحموضة 8.0.
            3. أضف ddH المعقم2س إلى 100 مل وتخلط جيدا.
            4. احفظه في درجة حرارة الغرفة.
            عازلة Tris-HCl (10 مم ، درجة الحموضة 8.0)
            1. أضف 10 مل من 0.1 مولار Tris-HCl.
            2. أضف 90 مل من ddH المعقم2يا وتخلط جيدا.
            3. احفظه في درجة حرارة الغرفة.
            عازلة تحلل (4٪ SDS ، 10 مم EDTA درجة الحموضة 8.0)
            1. أضف 20 مل من 20٪ SDS.
            2. أضف 10 مل من 0.1 M EDTA pH 8.0.
            3. أضف ddH المعقم2س إلى 100 مل وتخلط جيدا.
            4. احفظه في درجة حرارة الغرفة.
            محلول مخزون موتانولايسين (2500 وحدة / مل)
            1. أعد تكوين زجاجة mutanolysin بأكملها بـ ddH المعقم2O لإنتاج تركيز 2500 وحدة / مل.
            2. قسامة في أنابيب معقمة للطرد المركزي الدقيق أعلى المسمار.
            3. تخزين الكوات في -20 درجة مئوية.
            عازلة الهضم (0.04 جم / مل من الليزوزيم و 75 وحدة / مل متحولة في محلول TE)
            1. للحصول على 1 مل من محلول TE الذي يحتوي على الليزوزيم والمتحول ، أضف 40 مجم من الليزوزيم المجفف بالتجميد إلى أنبوب الطرد المركزي الدقيق سعة 1.5 مل.
            2. إضافة 1 مل عازلة TE.
            3. أضف 30 وميكرول من محلول مخزون من موتانوليسين عند 2500 وحدة / مل.
              • يجب تحضير هذا المحلول وقبل 15 دقيقة من استخدامه ولا يجب إعادة استخدامه.
            بروتيناز K (20 مجم / مل)
            1. حل 200 ملغ من مسحوق بروتيناز K في 10 مل من ddH المعقم2س.
            2. قسامة 1 مل في أنابيب ميكروسينتريفوجي.
            3. يخزن في درجة حرارة -20 درجة مئوية.
            هيالورونيداز (30 مجم / مل)
            1. يخفف 100 مجم في 3.3 مل من ddH المعقم2O لعمل 30 مجم / مل من المحلول.
            2. الاستغناء عن 500 & microl aliquots مخزن في -20 درجة مئوية.
            أسيتات الصوديوم (3.0 م ، درجة الحموضة 5.5)
            1. حل 40.8 غ من أسيتات الصوديوم في 80 مل من ddH المعقم2س.
            2. ضبط الأس الهيدروجيني إلى 5.5 مع حمض الخليك الجليدي.
            3. أضف ddH المعقم2O إلى الحجم النهائي 100 مل.
            4. الأوتوكلاف عند 121 درجة مئوية لمدة 20 دقيقة.
            5. احفظه في درجة حرارة الغرفة.
            الفينول: كلوروفورم (1: 1)
            1. تذوب الفينول الصلب أو السائل في حمام مائي 68 درجة مئوية. يجب تخزين الفينول السائل في درجة حرارة -20 درجة مئوية.
            2. اخلطي كميات متساوية من الفينول والكلوروفورم.
            3. أضف حجمًا متساويًا من 0.1 M Tris-HCl pH 7.6 للفينول.
            4. امزج لمدة 15 دقيقة ثم ضع الزجاجة مرة أخرى في حمام مائي للسماح بفصل المراحل.
            5. قم بإزالة الطبقة المائية العلوية قدر الإمكان.
            6. كرر الخطوة ب د حتى تصل الطبقة المائية العليا

            N. السحائية و المستدمية النزلية (جرام سالب)

            1. الاستغناء عن 1.0 مل من 10 مم تريس (درجة الحموضة 8.0) العازلة في 1.5 مل من أنابيب الطرد المركزي الدقيقة والتسمية.
            2. حصاد المستعمرات من 18-24 ساعة زراعات نقية من المستدمية النزلية أو N. السحائية باستخدام ممسحة معقمة من البوليستر أو حرير الرايون وقم بتدوير المسحة في المخزن المؤقت Tris لعمل تعليق عكر (مكافئ لمعيار McFarland 3.0). احرص على عدم التقاط قطع أجار على المسحة.
            3. دوامة لفترة وجيزة ويغلي تعليق الخلية عند 100 درجة مئوية لمدة 10 دقائق.
            4. المضي قدما على الفور مع PCR أو تخزينها في -20 درجة مئوية.
            بروتوكول استخراج الحمض النووي السريع ل الرئوية الرئوية (غرام إيجابي)
            1. الاستغناء عن 300 ومايكرول من 0.85٪ كلوريد الصوديوم في أنابيب 1.5 مل ميكروسينتريفوجي والملصق.
            2. حصاد الطوائف (استخدم 1 حلقه من 10 & microl loop) من 18-24 ساعة من المزارع النقية الرئوية الرئوية باستخدام بوليستر معقم أو ممسحة من الحرير الصناعي وقم بتدوير المسحة في 0.85٪ كلوريد الصوديوم لعمل تعليق عكر (مكافئ لمعيار McFarland 3.0). احرص على عدم التقاط قطع أجار على المسحة.
            3. دوامة لفترة وجيزة واحتضانها عند 70 درجة مئوية لمدة 15 دقيقة.
            4. جهاز الطرد المركزي الدقيق بسرعة 12000 x ز لمدة دقيقتين وإزالة المادة طافية.
            5. أعد التعليق في محلول TE 50 & microl (10 ملم Tris-HCl ، 100 & microM EDTA ، درجة الحموضة 8.0) وأضف 10 & microl mutanolysin (3000 U / ml) * و 8 & microl من هيالورونيداز (30 مجم / مل) **
            6. احتضان عند 37 درجة مئوية لمدة 30 دقيقة حتى 18 ساعة (بين عشية وضحاها).
            7. قم بتثبيط نشاط الإنزيمات في المعلق عن طريق الغليان عند 100 درجة مئوية لمدة 10 دقائق.
            8. جهاز الطرد المركزي الدقيق بسرعة 12000 x ز لمدة 4 دقائق وإزالة المادة طافية لاستخدامها كقالب DNA.
            9. المضي قدما على الفور مع PCR أو تخزينها في -20 درجة مئوية.

            الحواشي

            * موتانولايسين (10000 وحدة). خفف في 3.3 مل من محلول TE المؤقت لعمل 3000 وحدة / مل من محلول المخزون ، واحفظه في درجة حرارة -20 درجة مئوية على شكل 500 ومقسمة صغيرة.

            ** هيالورونيداز (100 مجم). خفف في 3.3 مل من محلول TE المؤقت لعمل 30 مجم / مل من المحلول ، واحفظه في درجة حرارة -20 درجة مئوية على شكل 500 درجة مئوية ومقسمة صغيرة.

              تحلل الخلايا البكتيرية الخطوة الأولى في استخراج وتنقية الحمض النووي البكتيري هي تحليل جدران الخلايا البكتيرية للحصول على أقصى إنتاجية من الحمض النووي. هناك طرق متعددة لتحليل الخلايا البكتيرية ، سواء فيزيائيًا أو كيميائيًا ، ويمكن تحسين هذه الخطوة من خلال النظر في البكتيريا المشتبه بها وبدء مادة العينة ، بالإضافة إلى المواد المتاحة لكل مختبر. عادةً ما تكون طرق التحلل الكيميائي أو الأنزيمي أسهل في الأداء ويمكن أن تكون أكثر فعالية من حيث التكلفة. على حد سواء N. السحائية و المستدمية النزلية سالبة الجرام ويمكن تحللها بشكل فعال باستخدام محلول تحلل يحتوي على البروتياز مثل بروتيناز K مع منظف. تختلف درجة حرارة ومدة الحضانة بين الكائنات الحية ومواد العينة. تتراوح درجة الحرارة المثلى لنشاط بروتيناز K بين 55-65 درجة مئوية. عند درجات حرارة أعلى من 65 درجة مئوية ، ينخفض ​​نشاط الإنزيم. ومع ذلك ، يمكن ترك العينات المحتضنة في درجة حرارة 37 درجة مئوية لفترات حضانة أطول دون التأثير على جودة الحمض النووي. يجب تحضين العينات حتى يتم مسح الخلايا تمامًا (عندما يتم مسح المحلول) وسيختلف الوقت بين العينات. بمجرد أن تتحلل البكتيريا تمامًا ، يجب أن ينتقل المرء إلى الخطوة التالية للحصول على عائد مثالي الرئوية الرئوية، وهو إيجابي الجرام ، فإن هضم الإنزيم الإضافي مع الليزوزيم والموتانوليسين سيساعد على تحطيم المحتوى الأعلى من الببتيدوغليكان في جدار الخلية قبل أن يتم تحللها باستخدام المخزن المؤقت. ستعتمد درجة حرارة وطول فترة حضانة الإنزيم على تركيز ونوع الإنزيم المستخدم ، بالإضافة إلى محلول التحلل المستخدم. يتم استخدام الحضانة ذات درجة الحرارة المرتفعة ودورات التجميد / الذوبان المتكررة بشكل عام مع تركيزات أعلى من الخلايا ، كما هو الحال عند الاستخراج من الثقافات. يمكن إجراء التحلل الفيزيائي باستخدام مجانس خلية سائلة أو ضغط ، أو صوتنة ، أو اهتزاز بخرز زجاجي ، على الرغم من أن بعض هذه الطرق تتطلب معدات إضافية ومكلفة في بعض الأحيان ، وتميل إلى قص الحمض النووي إلى أجزاء أصغر.

            تحلل الإنزيم للعينات السريرية ذات المسببات غير المعروفة أو معلقات الخلايا إيجابية الجرام المعروفة (الرئوية الرئوية)

            1. تحضير عازلة الهضم (0.04 جم / مل من الليزوزيم و 75 وحدة / مل متحولة في محلول TE).
              • يجب تحضير هذا المحلول و 15 دقيقة قبل الاستخدام وعدم إعادة استخدامه.
            2. أضف 100 وميكرول من محلول الهضم إلى كل أنبوب ميكروسينتريفوجي.
            3. إضافة 200 ميكرول من تعليق خلية بكتيرية أو عينة سريرية لكل أنبوب ميكروسينتريفوجي. دوامة واحتضان عند 37 درجة مئوية لمدة 1 ساعة.
              • إذا كان حجم العينة أقل من 200 & microl ، فقم بتدوين الحجم في السجلات المعملية وأضف محلول TE إلى الحجم الإجمالي 200 & microl. إذا بدا أن أنبوب العينة فارغًا ، اغسل جوانب الأنبوب باستخدام محلول عازلة 200 و microl TE.
            4. إضافة 200 & ميكرول من العازلة تحلل الخلية لكل أنبوب ميكروسينتريفوجي.
            5. أضف 20 وميكرول من بروتيناز K (20 مجم / مل) واقلب كل أنبوب حتى تختلط المراحل تمامًا.
            6. احتضان عند 37 درجة مئوية لمدة 30 دقيقة إلى 1 ساعة.
            7. تنقية الحمض النووي قبل استخدامه في تفاعلات تفاعل البوليميراز المتسلسل في الوقت الفعلي.

            تحلل الإنزيم للعينات السريرية المعروفة سالبة الجرام أو المعلقات الخلوية (N. السحائية و المستدمية النزلية)

            1. إعداد المخزن المؤقت لتحلل الخلية (4٪ SDS ، 1 مم EDTA درجة الحموضة 8.0).
            2. إضافة 200 & ميكرول من العازلة تحلل لكل أنبوب ميكروسينتريفوجي.
            3. أضف 200 ميكرول من تعليق الخلية البكتيرية أو العينة السريرية (السائل النخاعي ، أو المصل ، أو الدم) لكل أنبوب من أجهزة الطرد المركزي الدقيقة.
            4. أضف 20 وميكرول من بروتيناز K (20 مجم / مل) لتركيز نهائي قدره 1 مجم / مل وقلب كل أنبوب حتى تختلط المراحل تمامًا.
            5. احتضان عند 37 درجة مئوية لمدة 30 دقيقة إلى 1 ساعة.
            6. تنقية الحمض النووي قبل استخدامه في تفاعلات تفاعل البوليميراز المتسلسل في الوقت الفعلي.

            تحضير معطف بافي

            1. جهاز طرد مركزي لعينة الدم بسرعة 2500 × ز لمدة 10 دقائق في درجة حرارة الغرفة.
            2. يجب أن تظهر ثلاث طبقات بعد الطرد المركزي. يجب أن تكون الطبقة العلوية صافية وتحتوي على مادة البلازما. الطبقة الوسطى ذات اللون الأسمر الفاتح هي الطبقة المصقولة وتحتوي على كريات الدم البيضاء المركزة. تحتوي الطبقة الحمراء السفلية على كريات الدم الحمراء.

            الفينول / كلوروفورم لإزالة بقايا الخلايا والبروتينات

            الفينول مذيب عضوي خطير ويجب اتخاذ احتياطات السلامة عند العمل مع الفينول. استخدم دائمًا قفازات الحماية الكيميائية المناسبة عند التعامل مع المحاليل المحتوية على الفينول. قد تكون هناك حاجة لإجراءات نفايات محددة للتخلص من المحاليل المحتوية على الفينول.

            1. أضف حجمًا متساويًا من الفينول: محلول الكلوروفورم (1: 1). تخلط جيدا عن طريق الانقلاب أو الدوامة لفترة وجيزة.
            2. الطرد المركزي الأنبوب في 16000 س زلمدة 15 دقيقة في جهاز طرد مركزي.
            3. قم بإزالة الطبقة المائية العلوية بعناية من طبقة الفينول السفلية ونقلها إلى أنبوب جديد ، مع الحرص على تجنب الواجهة.
            4. يمكن تكرار الخطوات من 1 إلى 3 حتى تصبح الواجهة غير مرئية.
            5. لإزالة جميع آثار الفينول ، أضف كمية متساوية من الكلوروفورم إلى الطبقة المائية وطرد الأنبوب عند 16000 × زلمدة 15 دقيقة في جهاز طرد مركزي.
            6. قم بإزالة الطبقة المائية العلوية بعناية من طبقة الكلوروفورم السفلية ونقلها إلى أنبوب جديد ، مع الحرص على تجنب الواجهة.
            7. يمكن تكرار الخطوات من 5 إلى 6 حتى تصبح الواجهة غير مرئية.
            8. يعجل الحمض النووي بواسطة الإيثانول أو الأيزوبروبانول.

            ترسيب الحمض النووي بواسطة الإيثانول أو الأيزوبروبانول

            1. أضف حجمًا 0.1 (1 / 10th) من 3.0 M أسيتات الصوديوم (درجة الحموضة 5.5) إلى المرحلة المائية ثم مجلدين من 95 ٪ من الإيثانول. احتضان عند -20 درجة مئوية بين عشية وضحاها أو لفترات أقصر عند -80 درجة مئوية (على سبيل المثال 20-30 دقيقة). تابع مع الخطوة 3.
            2. إذا تم استخدام الأيزوبروبانول: أضف 0.1 حجمًا من أسيتات الصوديوم 3.0 مولار (الرقم الهيدروجيني 5.5) إلى المرحلة المائية ثم 0.6 حجمًا من الأيزوبروبانول بنسبة 100٪. احتضان عند -20 درجة مئوية لمدة ساعتين أو لفترات أقصر عند درجة حرارة -80 درجة مئوية (على سبيل المثال ، 10-20 دقيقة).
            3. جهاز طرد مركزي عند 16000 × جم لمدة 30 دقيقة عند 4 درجة مئوية.
            4. استعادة الحمض النووي المترسب عن طريق الطرد المركزي للأنبوب عند 16000 × جم لمدة 15 دقيقة عند 4 درجة مئوية. قم بإزالة المرحلة المائية بعناية.
            5. أضف مجلدين (من العينة الأصلية) 75٪ (حجم / حجم) إيثانول واتركه في درجة حرارة الغرفة لمدة 5-10 دقائق لإزالة الملح الزائد وآثار الفينول والكلوروفورم من الحبيبات.
            6. الطرد المركزي 16000 x g لمدة 5 دقائق. إزالة الإيثانول بعناية قدر الإمكان من أنبوب microcentrifuge باستخدام طرف ماصة تمت تصفيته لتجنب إزاحة الحبيبات.
            7. جفف بيليه الحمض النووي في الهواء ، في مجفف ، أو في فرن 50 درجة مئوية لمدة 5 دقائق.
            8. يمكن إذابة الحمض النووي المجفف في محلول تريس معقم (10 ملي مولار Tris-HCl ، pH 8.0) وتخزينه عند 4 درجة مئوية لمزيد من المعالجة أو عند -20 درجة مئوية للتخزين طويل الأجل.

            يجب تخزين الحمض النووي المستخرج والمنقى في محلول شطف معين من مجموعة تجارية أو في محلول Tris (10 ملي مولار تريس- حمض الهيدروكلوريك ، درجة الحموضة 8.0). يمكن أيضًا استخدام الماء المقطر ولكن قد تتعرض هذه العينات للتحلل من التحلل المائي الحمضي. يمكن الاحتفاظ بالحمض النووي في درجة حرارة 4 درجة مئوية لفترات قصيرة وفي درجة حرارة -20 درجة مئوية للتخزين على المدى الطويل.

            1. أضف 120 جم من إيزوثيوسيانات الغوانيدينيوم (GuSCN) إلى 100 مل من 0.1 M Tris / HCl (الرقم الهيدروجيني 6.4) و 22 مل من 0.2 M EDTA (درجة الحموضة 8.0) و 2.6 جم من Triton X-100.
            2. يقلب طوال الليل في الظلام ليذوب.
            3. يُحفظ بعيدًا عن الضوء لمدة تصل إلى شهر واحد.
              • إن GuSCN سام ويجب توخي الحذر عند التعامل مع هذه المادة.
            1. أضف 120 جم من أيزوثيوسيانات الغوانيدينيوم (GuSCN) إلى 100 مل من 0.1 مولار تريس / حمض الهيدروكلوريك (الرقم الهيدروجيني 6.4).
            2. يقلب طوال الليل في الظلام ليذوب.
            3. يحفظ بعيداً عن الضوء لمدة شهر.
            1. أضف 60 جم ​​من ثاني أكسيد السيليكون إلى 500 مل من الماء المقطر في أسطوانة مدرجة واتركها في درجة حرارة الغرفة لمدة 24 ساعة.
            2. قم بإزالة وتجاهل 430 مل من المادة الطافية وإعادة تعليق المواد الصلبة في 500 مل من ddH2س.
            3. اتركيه في درجة حرارة الغرفة لمدة 5 ساعات ثم أزيلي وتخلصي من 440 مل من المادة الطافية.
            4. أضف 600 وميكرول من حمض الهيدروكلوريك المركز (الرقم الهيدروجيني 2.0) ، واخلطه وقسمته في أحجام 1.5 مل.
            5. تعقيم عن طريق التعقيم بالبخار وتخزينه بعيدًا عن الضوء لمدة تصل إلى 6 أشهر.
            1. أضف 100 ميكرول من العينة (المعلق البكتيري أو العينة السريرية) إلى 500 وماكرول من محلول استخلاص L6 و 10 ميكرول من السيليكا المجزأة الحجم في أنبوب الطرد المركزي الدقيق 1.5 مل. لأحجام مزدوجة من العينة ، ضاعف كمية المخزن المؤقت لاستخراج L6 والسيليكا ، وكذلك الكواشف في خطوات الغسيل (محلول استخلاص L2 ، والإيثانول والأسيتون).
            2. دوامة الأنبوب لمدة 10 ثوانٍ واحتضانها مع الاهتزاز في درجة حرارة الغرفة لمدة 15 دقيقة.
            3. الطرد المركزي الأنبوب لمدة 15 ثانية عند 16100 x g والتخلص من المادة الطافية.
            4. اغسل الحبيبات مرتين بمخزن استخلاص 500 ومايكرول L2 ، مرتين مع 500 ومايكرول 70٪ من الإيثانول ومرة ​​واحدة مع 500 ومايكرول من الأسيتون. جهاز طرد مركزي لمدة 15 ثانية عند 16100 × جم بعد كل غسلة والتخلص من المادة الطافية باتباع الإجراءات المناسبة للنفايات الكيميائية.
            5. لإزالة الأسيتون ، ضع الأنبوب مع فتح الغطاء عند 56 درجة مئوية في كتلة تسخين جافة لمدة 5 دقائق.
            6. أزل الحمض النووي من السيليكا عن طريق إضافة 30 ميكرول من الماء المقطر ، وأغلق الأنبوب ، والدوامة ، واحتضنه عند 56 درجة مئوية لمدة 15 دقيقة.
            7. الطرد المركزي الأنبوب عند 16100 x g لمدة دقيقتين وجمع المادة الطافية ، مع الحرص على عدم تضمين أي سيليكا. يمكن تخزين الحمض النووي المستخرج في 4 درجة مئوية بين عشية وضحاها أو عند -70 درجة مئوية للتخزين على المدى الطويل.
            • جهاز التدوير الحراري PCR
            • خزانة احتواء حيوي غير مهواة أو غطاء PCR
            • الفريزر
            • ثلاجة
            • خزان الكهربائي
            • مزود الطاقة
            • طبق التحريك
            • فرن المايكرويف
            • نظام عرض جل
            • نظام التوثيق الجل
            • 10٪ مبيض (10: 1 ، ماء: مبيض مركز) (اجعله طازجًا أسبوعيًا)
            • 70٪ إيثانول
            • 1.5 مل من أنابيب الطرد المركزي الدقيقة (خالية من DNase المعقم أو درجة PCR)
            • 96 لوحًا جيدًا من البولي بروبلين أو شرائط أنبوبية أو فردية
            • مجموعة واحدة من المرئيات الدقيقة (1-10 ومايكرول ، 2-20 وماكرول ، 20-200 وماكرول ، و100-1000 وماكرول)
            • رؤوس فلتر معقمة مسبقًا (10 ومايكرول و 200 وماكرول و 1000 ومايكرول)
            • أغطية بصرية
            • بوليميريز الحمض النووي
            • dNTPs
            • تم تخفيف الحمض النووي الريبي الموجب والسلبي إلى حوالي 5 ميكروغرام / مل
            • المياه الصف PCR
            • TAE أو TBE العازلة
            • مسحوق الاغاروز (درجة البيولوجيا الجزيئية)
            • سلم الحمض النووي
            • 6x صبغة تحميل الحمض النووي
            • بروميد الايثيديوم
            • البروموفينول الأزرق
            • زيلين سيانول FF
            • السكروز

            1. قم بإذابة 18.6 جم EDTA في 70 مل من اليوم2س.
            2. ضبط الأس الهيدروجيني إلى 8.0 مع 10 M NaOH (

            بروميد إيثيديوم (EtBr) ، 10 مجم / مل

            1. قم بإذابة 0.2 جم من بروميد الإيثيديوم في 20 مل يوميًا2س.
            2. تخلط جيدا وتخزن في 4 درجة مئوية في الظلام في 1 مل قسامات.
            3. احفظه في درجة حرارة الغرفة.

            TAE (Tris / acetate / EDTA) العازلة الكهربائي ، 50 X محلول المخزون *

            1. 750 مل من ddH2أضف:
              • 242 جرام قاعدة تريس
              • 57.1 مل من حمض الخليك الجليدي
              • 100 مل من 0.5 M EDTA درجة الحموضة 8.0
            2. أضف ddH2س إلى 1000 مل ويخلط جيدا على طبق التقليب.
            3. احفظه في درجة حرارة الغرفة.

            هامش

            * يجب تخفيف محلول مخزون TAE إلى 1X في H.2يا قبل الاستخدام.

            TBE (تريس / بورات / EDTA) محلول الرحلان الكهربائي ، 10 × محلول مخزون *

            1. 900 مل من ddH2يضاف:
              • 108 جم تريس قاعدة (890 مم)
              • 55 جم حمض البوريك (890 مم)
              • 40 مل 0.5 م EDTA ، درجة الحموضة 8.0 (20 مم)
            2. أضف ddH2س إلى 1000 مل ويخلط جيدا على طبق التقليب.
            3. احفظه في درجة حرارة الغرفة.

            هامش

            * يجب تخفيف محلول مخزون TBE إلى 0.5X في H.2يا قبل الاستخدام.

            1. 0.25٪ أزرق بروموفينول
            2. 0.25٪ زيلين سيانول FF
            3. 40٪ (وزن / حجم) سكروز في الماء
            4. يخزن في 4 درجة مئوية.
            1. 0.25٪ أزرق بروموفينول
            2. 0.25٪ زيلين سيانول FF
            3. 30٪ جلسرين في الماء
            4. يخزن في 4 درجة مئوية.
            1. أضف 2 جم من agarose بدرجة الرحلان الكهربي إلى 100 مل من 1X TAE أو 0.5X TBE في دورق أو زجاجة سعة 250 مل.
            2. قم بإذابة الاغاروز في الميكروويف حتى يذوب الاغاروز بالكامل ويصبح المحلول صافياً. قم بتدوير الدورق عدة مرات أثناء تسخينه في الميكروويف لتجنب الغليان والانسكاب.
            3. تبرد إلى 55-60 درجة مئوية ثم أضف 5 ميكرول EtBr لتركيز نهائي 0.5 ميكروغرام / مل.
              • EtBr مادة مسرطنة قوية ويجب التعامل معها بحذر.

            التمهيدي حل مخزون العمل

            يجب أن يكون محلول مخزون العمل التمهيدي 20 ميكرومتر.

            قبل بدء PCR ، خطط للتجربة عن طريق ملء وطباعة ورقة عمل قالب لوحة. تأكد أيضًا من توفر كميات كافية من حلول العمل التمهيدي لاستخدامها.

            1. قم بإزالة قوالب الحمض النووي والحمض النووي ذي التحكم الإيجابي من -20 درجة مئوية إلى منطقة إضافة الحمض النووي للسماح لها بالذوبان تمامًا.
            2. في منطقة تجميع تفاعل تفاعل البوليميراز المتسلسل ، اجمع الكواشف اللازمة لتفاعلات تفاعل البوليميراز المتسلسل ، بما في ذلك المزيج الرئيسي لـ PCR ، والبادئات ، وماء درجة PCR. إذا تم تخزين الكواشف في درجة حرارة -20 درجة مئوية ، اتركها تذوب تمامًا ودوامة أو نفض الغبار عن كل أنبوب قبل الاستخدام.
            3. يتم تحضير تفاعلات تفاعل البوليميراز المتسلسل متعدد الإرسال المتسلسل ، استنادًا إلى أحد المخططات الموصوفة ، في أحجام تفاعل قياسية 25 و microl باستخدام بادئات وتركيزات موصوفة في الجدول 5.
            4. يجب أن يحتوي كل تفاعل PCR على:
              • 200 وميكرو مولار (لكل منهما) من ثلاثي فوسفات ديوكسينوكليوزيد (dNTPs)
              • 3.5 ملي MgCl2
              • 2 وحدة طاق DNA بوليميراز
              • التمهيدي إلى الأمام (الجدول 5)
              • التمهيدي العكسي (الجدول 5)
              • 2.5 وميكرول من قالب الحمض النووي من العزلات (استخدم 5 ومايكرول للعينات السريرية)
              • الماء من الدرجة PCR إلى 25 وماكرول
            5. يمكن تحضير مزيج رئيسي ، والذي يتضمن جميع المكونات المذكورة أعلاه باستثناء قالب DNA. عند حساب أحجام كواشف المزيج الرئيسي ، تذكر إضافة ما يكفي من كواشف المزيج الرئيسي لتفاعلين إضافيين أكثر من عدد العينات التي سيتم اختبارها لضمان وجود مزيج رئيسي كافٍ.
            6. الماصة 22.5 وماكرول من هذا المزيج الرئيسي في كل بئر مناسبة من لوحة 96 جيدًا ، وفقًا لورقة عمل قالب اللوحة الخاصة بك.
            7. قم بتغطية آبار الطبق باستخدام شرائح الغطاء. رش مساحة العمل النظيفة بنسبة 10٪ مبيض (10: 1 ماء: مبيض مركز) وامسح. كرر مع 70٪ كحول. قم بإزالة معطف المختبر والقفازات. ارتدِ زوجًا جديدًا من القفازات. نقل بعناية لوحة 96-جيدا إلى منطقة إضافة الحمض النووي.
            8. ارتدِ معطفًا جديدًا للمختبر واحتفظ بنفس زوج القفازات. قم بإزالة شرائط الغطاء من اللوحة. أضف 2.5 وميكروول من الحمض النووي للقالب إلى كل بئر مناسبة من لوحة 96 جيدًا ، وفقًا لورقة عمل قالب اللوحة.
            9. يجب إعداد عنصر تحكم سلبي واحد وإيجابي واحد على الأقل لكل نمط مصلي لكل تشغيل PCR.
              • التحكم السلبي: إضافة 2.5 & microl DNA العازلة إلى تفاعل جيد بدلاً من قالب DNA.
              • التحكم الإيجابي: أضف 2.5 وميكرول من قالب الحمض النووي المعروف باحتوائه على التسلسل المضخم إلى بئر التفاعل.
            10. أعمدة سقف الآبار كما تذهب. استخدم أداة الأسطوانة لتثبيت الأغطية بإحكام.
            11. امسح مساحة العمل المتسخة بنسبة 10٪ مبيض ، ثم 70٪ إيثانول. قم بإزالة معطف المختبر والقفازات. إذا كان ذلك ممكنًا ، قم بتدوير اللوحة بسرعة عند 1000 دورة في الدقيقة لإسقاط أي قطرات. لوحة النقل مباشرة ووضعها في جهاز التدوير الحراري PCR.
            12. يتم استخدام شروط PCR التالية:
              • دورة واحدة من 94 درجة مئوية لمدة 4 دقائق
              • 30 دورة من 94 درجة مئوية لمدة 45 ثانية و 54 درجة مئوية لمدة 45 ثانية و 72 درجة مئوية لمدة دقيقتين
              • دورة واحدة من 72 درجة مئوية لمدة دقيقتين
            13. المنهجيات الحالية مفصلة على موقع CDC

            تحليل منتجات PCR على هلام الاغاروز

            يتم تشغيل منتجات PCR (10 & microl) على 2٪ من المواد الهلامية agarose لتحديد أحجام الحزام باستخدام عناصر تحكم إيجابية. يجب تضمين عنصر تحكم إيجابي لكل نمط مصلي وعلامة حجم جزيئي سلم 50 نقطة أساس على كل هلام.

              قم بإذابة هلام الاغاروز 2٪ في فرن الميكروويف. قم بتبريد الأجار إلى درجة 55 درجة مئوية تقريبًا. أضف بروميد الإيثيديوم أو بقعة هلامية أخرى. اسكبه في شريط الصب الهلامي ، وأدخل المشط ، واترك وقتًا للتصلب (

            يجب أن تتطابق أحجام النطاق الموجودة على agarose gelsm مع تلك الموجودة في الضوابط الإيجابية قبل تعيين النمط المصلي المفترض (الشكل 5). يتم إعداد تفاعلات تفاعل البوليميراز المتسلسل بشكل تسلسلي وستتضمن تلك الأنماط المصلية التي يتم تحديدها بشكل متكرر لكل من المخططات. على سبيل المثال ، إذا كانت السلالة سلبية لأي من الأنماط المصلية المتضمنة في التفاعل 1 ، فانتقل إلى التفاعل 2 وما إلى ذلك حتى يتم تحديد النمط المصلي. إذا اكتملت جميع التفاعلات لمخطط معين ولم يتم تحديد أي نطاقات نمط مصلي تطابق أيًا من عناصر التحكم الإيجابية ، فقد تكون السلالة غير قابلة للكتابة أو أحد الأنماط المصلية التي لم يتم تضمينها بعد في المخطط وستحتاج إلى مزيد من كتابتها باستخدام Quellung رد الفعل (انظر الفصل 8: تحديد وتوصيف العقدية الرئوية). يمكن أن يكون حل الأنماط المصلية الفردية في بعض ردود الفعل الإيجابية قابلاً للتطبيق في بعض الظروف. على سبيل المثال ، لحل رد الفعل الإيجابي PCR لـ 12F / 12A / 44/46 (التفاعل 3 في الجدول 6) ، قم بإجراء تفاعل Quellung باستخدام مادة مضادة خاصة بالنوع لتحديد ما إذا كانت السلالة تحتوي على 12F أو 12A أو 44 أو 46 نوع المحفظة. يجب الإشارة إلى أنه لأسباب عملية لا يكون هذا ضروريًا في العادة. على سبيل المثال ، يتم اكتشاف النمط المصلي 12F بشكل شائع في عينات الأمراض والعربات ، في حين أن الأنماط المصلية 12A و 44 و 46 نادرة للغاية.

            شريط التحكم الموجب للمكورات الرئوية ل cps يمكن أن تكون سالبة في 1-2٪ من العزلات القابلة للنمط المصلي من تفاعل البوليميراز المتسلسل. يحدث هذا غالبًا في الأنماط المصلية 25 و 38 ، ولكن نادرًا ما يتم العثور عليه في الأنماط المصلية 14 و 35 أ. على الرغم من أن أ cps النتيجة السلبية نادرة نسبيًا ، في الوقت الحالي سلبية cps لا يعني بالضرورة عزلًا غير قابل للنمط المصلي أو عينة سريرية سلبية المكورات الرئوية.

            يجب تشغيل عنصر تحكم إيجابي لكل نمط مصلي متضمن في تفاعل (تفاعلات) تفاعل البوليميراز المتسلسل (PCR) على كل مادة هلامية لضمان تعيين العصابات على النمط المصلي الصحيح.

            الجدول 2. مواد أولية ومجسات تستخدم للكشف عن مسببات التهاب السحايا الجرثومي

            الجدول 2. مواد أولية ومجسات تستخدم للكشف عن مسببات التهاب السحايا الجرثومي
            استهداف التمهيدي أو اسم المسبار متواليات النوكليوتيدات الأولية والمجسات في الوقت الحقيقي (5 & Prime to 3 & Prime) العمل على الأسهم (& microM) الحفرة النهائية (نانومتر) تعديلات المسبار المقترحة
            N. السحائية
            ctrA F753 تجتجتككجكتاتاكجككات 3.75 300
            R846 GCCATATTCACACGATATACC 11.25 900
            Pb820i AACCTTGAGCAA و rdquoT و rdquoCCATTTA
            تككتجاكجتكت
            1.25 100 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            sodc F351 GCACACTTAGGTGATT
            تاككتجكات
            3.75 300
            R478 CCACCCGTGTGATCATAATAGA 7.5 600
            Pb387 كاتجاتجكاكاجكاكا
            تككتجت
            1.25 100 5 & ​​Prime FAM، 3 & Prime BHQ1
            المستدمية النزلية
            حصان هبدف 822 جتافاتاتجككاتجتجتج 1.25 100
            هب دي آر 952 تجكاتكتتاكجكاكجتجتتا 3.75 300
            Pb896i TTGTGTACACTCCGT & rdquoT & rdquoGGT
            AAAAGAACTTGCAC
            1.25 100 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            الرئوية الرئوية
            ليتا F373 أكجكاتكتاجكاجاتجاغكا 2.5 200
            R424 TCGTGCGTTTTAATTCCAGCT 2.5 200
            Pb400i TGCCGAAAACGC و rdquoT و rdquoTGATAC
            AGGGAG
            2.5 200 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            الحمض النووي البشري
            RNAaseP RNAsePF CCA AGT GTG AGG GCT GAA AAG 4 400
            RNAsePR TGT TGT GGC TGA TGA
            ACT ATA AAA GG
            4 400
            RNAsePPb CCC CAG TCT CTG TCA GCA
            CTC CCT TC
            1 100 5 & ​​Prime FAM، 3 & Prime BHQ1

            الجدول 3. الاشعال والتحقيقات المستخدمة للكشف عن المجموعات المصلية من N. السحائية

            الجدول 3. الاشعال والتحقيقات المستخدمة للكشف عن المجموعات المصلية من N. meningitidis
            استهداف التمهيدي أو اسم المسبار متواليات النوكليوتيدات الأولية والمجسات في الوقت الحقيقي (5 & Prime to 3 & Prime) العمل على الأسهم (& microM) الحفرة النهائية (نانومتر) تعديلات المسبار المقترحة
            Nm أ F2531 AAAATTCAATGGTATATCACGAAGA 3.75 300
            سايب R2624 أتاتجتجكاجكتجتتكاتاج 11.25 900
            Pb2591i CTAAAAG و rdquoT و rdquoAGGAAGGGCACT
            TTGTGGCATAAT
            1.25 100 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            نانومتر ب F737 جكتاككككاتتكاجاتجتجت 3.75 300
            التزامن R882 ACCAGCCGAGGGTTATTTCTAC 3.75 300
            Pb839i AAGAGATGGGYAACAAC و rdquoT و rdquoATGT
            AATGTCTTTATTT
            1.25 100 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            نانومتر ج F478 ككتجاجتاتجكجااااات 11.25 900
            مزامنة R551 تجكتاتكككجككتغاتج 3.75 300
            Pb495i TTTCAATGC & rdquoT & rdquoAATGAATACCAC
            CGTTTTTTTGC
            1.25 100 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            نيوتن متر W135 F857 TATTTATGGAAGGCATGTGTATG 1.25 100
            سينج R964 تجككاتكاجااتكاك 11.25 900
            Pb907i AAATATGGAGCGAATGATTACAGT
            اكتاتاتجا
            2.5 200 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            نانومتر X F173 تجتكككاككجتتاتج 11.25 900
            xcbB R237 تجكتجكتاتكاتاجككجكك 11.25 900
            Pb196 تجتتجككاكاتجاتجكج 1.25 100 5 & ​​Prime FAM، 3 & Prime BHQ1
            نانومتر ص F787 تكجاجكاجااتتاتجاجاتاك 11.25 900
            التزامن R929 تجكتاآاتكاتكجكتككاتات 7.5 600
            Pb1099i TATGGTG & rdquoT & rdquoACGATCCCTATCC
            تجككتاتات
            1.25 100 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6

            الجدول 4. الاشعال والتحقيقات المستخدمة للكشف عن الأنماط المصلية المستدمية النزلية

            الجدول 4. الاشعال والتحقيقات المستخدمة للكشف عن الأنماط المصلية من المستدمية النزلية
            استهداف التمهيدي أو اسم المسبار متواليات النوكليوتيدات الأولية والمجسات في الوقت الحقيقي (5 & Prime to 3 & Prime) العمل على الأسهم (& microM) الحفرة النهائية (نانومتر) تعديلات المسبار المقترحة
            مرحبًا أ F261 GGT CTG CGG TGT CCT GTG T 1.25 100
            ACSB R427 CCG GTC ATC TTT TAT GCT CCA أ 3.75 300
            Pb375i TAA TTT TCT TGC & ldquoT & rdquoCA ATA CCG CCT TCC CA 1.25 100 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            مرحبا ب F192 TGA TGC ATT GAA AGA AGG TGT AAT TT 3.75 300
            bcsB R359 CCT GCG GTA ATA ACA TGA TCA TAA A 7.5 600
            Pb244i TGT CGT GCA G & rdquoT & rdquoA GCA AAC CGT AAC CTT ACT C 1.25 100 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            مرحبًا ج F7667 كات TGG TGA TGG TTC AGT TAT TGG 7.5 600
            ccsD R7784 TAC AGC ATT CAG CAA TAA TGG G 3.75 300
            Pb7726i ATT GCA & ldquoT & rdquoCG CCG CAG GAG TTC CCG 2.5 200 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            مرحبا د F2211 CCT AAA ATA CGG ACC TAG TGC AC 7.5 600
            دكس R2255 CCG ATG AGA CCA AGT ATG GTT أ 1.25 100
            Pb2221i AAC GAG C & rdquoT & rdquoA GAG CTG GTG CTG AA 3.75 300 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            مرحبا ه F1523 ACT AAA ATA TGG CCC AAA CCC AC 7.5 600
            ecsH R1589 CCG ATG AGC CCA AGT ATG ATG A 7.5 600
            Pb1555i AAC GAG CAA AAG CCG G & rdquoT & rdquoG CGG AT 2.5 200 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6
            مرحبًا و F7164 CCC TGA AAA GCG TTG ACT TTG 7.5 600
            bexD R7313 CCA ACT TCA GGA CCA AGT CAT TC 3.75 300
            Pb7242i TGC TGC TAA C & rdquoT & rdquoC AGA TGC ATC AGC TCC TT 2.5 200 5 & ​​Prime FAM، BHQ1 on & ldquoT & rdquo، 3 & prime SpC6

            الجدول 5. قائمة الاشعال المستخدمة في خصم النمط المصلي من المكورات الرئوية. يرجى ملاحظة أنه يجب استخدام هذا الموقع كمصدر أساسي لتسلسلات وبروتوكولات التمهيدي بسبب التحسينات الدورية المقدمة.

            * يتم سرد جميع الأنماط المصلية التي تم اكتشافها بشكل مشترك

            الجدول 5. قائمة الاشعال المستخدمة في خصم النمط المصلي من المكورات الرئوية.
            استهداف التمهيدي أو اسم المسبار متواليات النوكليوتيدات الأولية والمجسات في الوقت الحقيقي (5 & Prime to 3 & Prime) العمل على الأسهم (& microM) الحفرة النهائية (نانومتر)
            1-و CTC TAT AGA ATG GAG TAT ATA AAC TAT GGT TA wzy 0.3 280
            1 ص CCA AAG AAA ATA CTA ACA TTA TCA CAA TAT TGG C 0.3
            2-و TAT CCC AGT TCA ATA TTT CTC CAC TAC ACC wzy 0.3 290
            2-ص ACA CAA AAT ATA GGC AGA GAG AGA CTA CT 0.3
            3-و ATG GTG TGA TTT CTC CTA GAT TGG AAA GTA G فتاهيو 0.3 371
            3 ص CTT CTC CAA TTG CTT ACC AAG TGC AAT AAC G 0.3
            4-و أ CTG TTA CTT GTT CTG GAC TCT CGA TAA TTG G wzy 0.3 430
            4 ص دول مجلس التعاون الخليجي كاك TCC TGT TAA AAT CCT ACC CGC ATT G 0.3
            5-و ATA CCT ACA CAA CTT CTG ATT ATG CCT TTG TG wzy 0.3 362
            5 ص GCT CGA TAA ACA TAA TCA ATA TTT GAA AAA GTA TG 0.3
            6A / 6B / 6C / 6D -f AAT TTG TAT TTT ATT CAT GCC TAT ATC TGG WCIص 0.3 250
            6A / 6B / 6C / 6D -r TTA GCG GAG ATA ATT TAA AAT GAT GAC TA 0.3
            6C / 6D -f CAT TTT AGT GAA GTT GGC GGT GGA GTT WCIنبيتا 0.5 727
            6C / 6D -r AGC TTC GAA GCC CAT ACT CTT CAA TTA 0.5
            7C / (7B / 40) -f CTA TCT CAG TCA TCT ATT GTT AAA GTT TAC GAC GGG A wcwإل 0.3 260
            7C / (7B / 40) -r GAA CAT AGA TGT TGA GAC ATC TTT TGT AAT TTC 0.3
            7F / 7A-f TCC AAA CTA TTA CAG TGG GAA TTA CGG wzy 0.4 599
            7F / 7A-r ATA GGA ATT GAG ATT GCC AAA GCG AC 0.4
            8-ص GAA GAA ACG AAA CTG TCA GAG CAT TTA CAT wzy 0.2 201
            8 ص CTA TAG ATA CTA GTA GAG CTG TTC TAG TCT 0.2
            9N / 9L-f GAA CTG AAT AAG TCA GAT TTA ATC AGC wzx 0.5 516
            9N / 9L-r ACC AAG ATC TGA CGG GCT AAT CAA T 0.5
            9V / 9A-f GGG TTC AAA G TC AGA CAG TG A ATC TTA A wzy 0.5 816
            9 فولت / 9 أمبير CCA TGA ATG A AA TCA ACA TT G TCA GTA GC 0.5
            10A- و GGT GTA GAT TTA CCA TTA GTG TCG GCA GAC wcrجي 0.5 628
            10A- ص GAA TTT CTT TAA GAT TCG GAT ATT TCT C 0.5
            10F / (10C / 33C) - ص GGA GTT TAT CGG TAG TGC TCA TTT TAG CA wzx 0.3 248
            10F / (10C / 33C) -r CTA ACA AAT TCG CAA CAC GAG GCA ACA 0.3
            11A / 11D-f GGA CAT GTT CAG GTG ATT TCC CAA TAT AGT G wzy 0.3 463
            11A / 11D-r جات تات غاغ TGT AAT TTA TTC CAA CTT CTC CC 0.3
            12F / (12A / 44/46) -f GCA ACA AAC GGC GTG AAA GTA GTT G wzx 0.5 376
            12F / (12A / 44/46) -r CAA GAT GAA TAT CAC TAC CAA TAA CAA AAC 0.5
            13 و TAC TAA GGT AAT CTC TGG AAA TCG AAA GG wzx 0.4 655
            13 ص CTC ATG CAT ATT AAC CG C TTT TTG TTC 0.4
            14 ص GAA ATG TTA CTT GGC GCA GGT GTC AGA ATT wzy 0.3 189
            14 ص مجلس التعاون الخليجي AAT ACT TCT TAG TCT CTC AGA TGA AT 0.3
            15A / 15F-f ATT AGT ACA GCT GCT GGA ATA TCT CTT ج wzy 0.3 434
            15A / 15F-r GAT CTA GTG AAC GTA CTA TTC CAA AC 0.3
            15B / 15C-f TTG GAA TTT AAT TAG TGG CTT ACC TA wzy 0.3 496
            15B / 15C-r CAT CCG CTT ATT AAT TGA AGT AAT CTG AAC C 0.3
            16F-f ، GAA TTT TTC AGG CGT GGG TGT TAA AAG wzy 0.4 717
            16F- ص CAG CAT ATA GCA CCG CTA AGC AAA TA 0.4
            17F-f TTC GTG ATG ATA ATT CCA ATG ATC AAA CAA GAG WCIص 0.5 693
            17F- ص GAT GTA ACA AAT TTG TAG CGA CTA AGG TCT GC 0.5
            18 / (18A / 18B / 18C / 18F) -f CTT AAT AGC TCT CAT TAT TCT TTT TTT AAG CC wzy 0.3 573
            18 / (18A / 18B / 18C / 18F) -r TTA TCT GTA AAC CAT ATC AGC ATC TGA AAC 0.3
            19A-f GAG AGA TTC ATA ATC TTG CAC TTA GCC A wzy 0.3 566
            19 أ- ص CAT AAT AGC TAC AAA TGA CTC ATC GCC 0.3
            19F-f GTT AAG ATT GCT GAT CGA TTA ATT GAT ATC C. wzy 0.5 304
            19F-r GTA ATA TGT CTT TAG GGC GTT TAT GGC GAT AG 0.5
            20 ف GAG CAA GAG TTT TTC ACC TGA CAG CGA GAA G WCIإل 0.3 514
            20 ص CTA AAT TCC TGT AAT TTA GCT AAA ACT CTT ATC 0.3
            21 و CTA TGG TTA TTT CAA CTC AAT CGT CAC C wzx 0.2 192
            21 ص GGC AAA CTC AGA CAT AGT ATA GCA TAG 0.2
            22F / 22A-f GAG TAT AGC CAG ATT ATG GCA GTT TTA TTG TC wcwالخامس 0.5 643
            22F / 22A-r CTC CAG CAC TTG CGC TGG AAA CAA CAG ACA AC 0.5
            23A-f TAT TCT AGC AAG TGA CGA AGA TGC G wzy 0.5 722
            23 أ- ص CCA ACA TGC TTA AAA ACG CTG CTT TAC 0.5
            23B-و CCA CAA TTA G CG CTA TAT TCA TTC AAT CG wzx 0.2 199
            23B- ص GTC CAC GCT GAA TAA AAT GAA GCT CCG 0.2
            23F-f أ GTA ACA GTT GCT GTA GAG GGA ATT GGC TTT TC wzy 0.5 384
            23F- ص CAC AAC ACC TAA CAC TCG ATG GCT ATA TGA TTC 0.5
            24A / 24B / 24F-f GCT CCC TGC TGT AAT CTT TAA AGA G wzy 0.2 99
            24A / 24B / 24F-r GTG TCT TTT ATT GAC TTT ATC ATA GGT CGG 0.2
            31 ص GGA AGT TTT CAA GGA TAT GAT AGT GGT GGT GC wzy 0.5 701
            31 ص CCG AAT ATA TTC AAT ATA TTC CTA CTC 0.5
            33F / 33A / 37-f GAA GGC AAT CAA TGT GAT TGT GTC GCG wzy 0.3 338
            33F / 33A / 37-r CTT CAA AAT GAA GAT TAT AGT ACC CTT CTA C 0.3
            34 ص GCT TTT GTA AGA GGA GAT TAT TTT CAC CCA AC wzy 0.3 408
            34 ص CAA TCC GAC TAA GTC TTC AGT AAA AAA CTT TAC 0.3
            35A / 35C / 42-f ATT ACG ACT CCT TAT GTG ACG CGC ATA wzx 0.3 280
            35A / 35C / 42-r CCA ATC CCA AGA TAT ATG CAA CTA GGT T 0.3
            35B-و GAT AAG TCT GTT GTG GAG ACT TAA AAA GAA TG wcrح 0.5 677
            35B- ص CTT TCC AGA TAA TTA CAG GTA TTC CTG AAG CAA G 0.5
            35F / 47F-f GAA CAT AGT CGC TAT TGT ATT TTA TTT AAA GCA A wzy 0.3 517
            35F / 47F- ص GAC TAG GAG CAT TAT TCC TAG AGC GAG TAA ACC 0.3
            38 / 25F-f CGT TCT TTT ATC TCA CTG TAT AGT ATC TTT ATG wzy 0.3 574
            38 / 25F-r ATG TTT GAA TTA AAG CTA ACG TAA CAA TCC 0.3
            39 ف TCA TTG TAT TAA CCC TAT GCT TTA TTG GTG wzy 0.2 98
            39 ص GAG TAT CTC CAT TGT ATT GAA ATC TAC CAA 0.2
            cpsأ-و GCA GTA CAG CAG TTT GTT GGA CTG ACC wzg 0.1 160
            cpsأ-ر GAA TAT TTT CAT TAT CAG TCC CAG TC 0.1

            الجدول 6. مخطط التنميط المصلي PCR في الولايات المتحدة الأمريكية بناءً على انتشار النمط المصلي الحالي

            الجدول 6. مخطط التنميط المصلي PCR للولايات المتحدة الأمريكية على أساس انتشار النمط المصلي الحالي
            رد فعل وشملت الأنماط المصلية
            1 6A / 6B / 6C / 6D، 3، 19A، 22F / 22A، 16F
            2 8 ، 33F / 33A / 37 ، 15A / 15F ، 7F / 7A ، 23A
            3 19F ، 12F / 12A / 44/46 ، 11A / 11D ، 38 ، 35B
            4 24A / 24B / 24F ، 7C / 7B / 40 ، 4 ، 18A / 18B / 18C / 18F ، 9V / 9A
            5 14 ، 1 ، 23 فهرنهايت ، 15 ب / 15 ج ، 10 أ
            6 39 ، 10F / 10C / 33C ، 5 ، 35F / 47F ، 17F
            7 23B ، 35A / 35C / 42 ، 34 ، 9N / 9L ، 31
            8* 6A / 6B / 6C / 6D ، 6C / 6D

            * يتم إجراؤه فقط إذا كان تفاعل البوليميراز المتسلسل إيجابيًا لـ 6A / 6B / 6C / 6D في التفاعل 1

            الجدول 7. مخطط التنميط المصلي PCR لأفريقيا على أساس انتشار النمط المصلي الحالي

            الجدول 7. مخطط التنميط المصلي PCR لأفريقيا على أساس انتشار النمط المصلي الحالي
            رد فعل وشملت الأنماط المصلية
            1 14 ، 1 ، 5 ، 4 ، 18A / 18B / 18C / 18F
            2 6A / 6B / 6C / 6D ، 19F ، 23F ، 38 / 25F ، 9V / 9A
            3 7C / 7B / 40 ، 3 ، 15B / 15C ، 7F / 7A ، 17F
            4 8 ، 12F / 12A / 44/46 ، 9L / 9N ، 22F / 22A ، 23A
            5 24 أ / 24 ب / 24 ف ، 2 ، 11 أ / 11 د ، 19 أ ، 16 ف
            6 21 ، 33F / 33A / 37 ، 15A / 15F ، 35F / 47F ، 13
            7 39 ، 23 ب ، 35 أ / 35 ج / 42 ، 20 ، 35 ب
            8 10F / 10C / 33C ، 34 ، 10A ، 31
            9* 6A / 6B / 6C / 6D ، 6C / 6D

            * يتم إجراؤه فقط إذا كان تفاعل البوليميراز المتسلسل إيجابيًا لـ 6A / 6B / 6C / 6D في التفاعل 2

            الجدول 8. مخطط التنميط المصلي PCR لأمريكا اللاتينية على أساس انتشار النمط المصلي الحالي