معلومة

استنتج ترتيب الطول من 4 ديكاببتيدات بناءً على مؤامرة راماشاندران

استنتج ترتيب الطول من 4 ديكاببتيدات بناءً على مؤامرة راماشاندران



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لقد عثرت على سؤال الامتحان السابق التالي:

4 decapeptides A ، B ، C ، D ، مصنوعة فقط من بقايا الجلايسين ، لها مطابقة مختلفة ، وزوايا phi و psi للببتيدات الفردية موضحة في مؤامرة Ramachandran (لسوء الحظ لا يمكنني تقديم مؤامرة محددة). اطلب هذه الببتيدات عن طريق تقليل الطول.

كيف يمكنني حل هذا ، ما هي المعلومات المفيدة في حل هذه المشكلة التي يمكنني استنتاجها من مؤامرة راماشاندران؟


عندما φ = ψ = 180 درجة يكون الببتيد في التشكل الممتد بالكامل ، أي أنه `` الأطول ''.

إذا لم يكن من الممكن استنتاج ترتيب الطول بناءً على هذه المعلومات ، فأعتقد أنه سيتعين عليك القيام ببعض الهندسة لحساب مجموع المسافات بين ذرات α C باستخدام القيم المعروفة لجميع زوايا الرابطة - يبدو الأمر شاقًا إلي!

يقوم هذا الموقع بجدولة قيم φ / للهياكل النموذجية (اللولب ، الصفيحة ، الدوران) لذلك قد يكون من الممكن تحديد ما إذا كانت بعض الببتيدات تتبنى هذه.


تصف مؤامرة راماشاندران الهيكل الثانوي. إذا رأيت الكثير من أوراق بيتا في مخططك ، فسيكون لديك جزيء مضغوط أكثر من جزيء ألفا الحلزون بالكامل. يمكن أن يكون Gly في أي مكان تقريبًا في أي ربع. ابحث عن المخلفات ذات البنية الثانوية لتحديد البنية الثلاثية.


الفصل 1 - الاستقرار وتصميم α- الببتيدات الحلزونية

ال α- الحلزون هو العنصر الهيكلي الثانوي الأكثر وفرة في البروتينات وقد تمت دراسته بشكل مكثف باستخدام الببتيدات التي تشكل حلزونات معزولة في محلول مائي ، تتكون في الغالب من Ala ، مع محتوى حلزوني يقاس باستخدام ازدواج اللون الدائري. يدمج الحلزون بحكم التعريف ترجمة خطية مع دوران دائري متعامد. يتم إرضاء مجموعات الأميد NH في الطرف الحلزوني N في الغالب بواسطة متقبلات رابطة الهيدروجين ذات السلسلة الجانبية المحلية. في المقابل ، يتم إرضاء مجموعات الكربونيل CO عند الطرف C بشكل أساسي من خلال مجموعات NH الأساسية من التسلسل الذي يلي اللولب. أظهرت الهياكل البلورية البروتينية الأولى وفرة من α- القفزات ، مما يؤدي إلى تكهنات حول ما إذا كانت أجزاء التسلسل الحلزوني يمكن أن تكون مستقرة بمعزل عن غيرها. سيتطلب هذا أن تكون رابطة الهيدروجين أميد أميد قوية بما يكفي لمقاومة فقدان الانتروبيا التوافقية الناشئة عن تقييد الببتيد في بنية حلزونية. يكون تكوين اللولب في الببتيدات تعاونيًا ، مع عقوبة التنوي. لذلك يميل ثبات اللولب إلى الزيادة مع الطول ، في البوليمرات المتجانسة على الأقل. مع زيادة طول البوليمر المتجانس ، فإن حلزون الكسر المتوسط ​​سينخفض ​​إلى أقل من 100٪ ، حيث من المحتمل أن تنكسر الحلزونات الطويلة إلى قسمين.


خلفية

التقليب الدائري (CP) في بنية البروتين هو إعادة ترتيب تسلسل الأحماض الأمينية بحيث يتم تبادل المناطق الطرفية الأمينية والكربوكسية [1 ، 2]. يمكن تخيله كما لو أن المصطلح الأصلي لعديد الببتيد تم ربطه وإنشاء أخرى جديدة في مكان آخر [3 ، 4]. منذ الملاحظة الأولى للتباديل الدائري الذي يحدث بشكل طبيعي في الليكتينات النباتية [5] ، تم الإبلاغ عن عدد كبير من الأمثلة الطبيعية ، بما في ذلك بعض β-glucanases البكتيرية ، و swaposins ، و glucosyltransferases ، و β-glucosidases ، ومجالات SLH ، و transaldolases ، و C2 (لـ مراجعة ، انظر [6]) ، بروتينات ربط FMN [7] ، براميل مزدوجة بيتا بيتا [8] ، تركيبات الجلوتاثيون [9] ، DNA و methyltransferases أخرى [1 ، 10] ، ffixoxins [11] ، وبروتينيز مثبطات [12 ، 13]. في معظم الحالات ، حافظت المواد الثابتة الدائرية (CPs) على الوظيفة أو النشاط الأنزيمي [6 ، 14] ، وأحيانًا مع زيادة التنوع الوظيفي [15-17].

للكشف عن تأثيرات CP على بنية البروتينات ووظيفتها وآلية طيها ، تم إنشاء العديد من CPs الاصطناعية ، بما في ذلك مثبط التربسين ، إيزوميراز أنثرانيلات ، اختزال ثنائي هيدروفولات ، T4 ليزوزيم ، ريبونوكلياز ، أسبارتات ترانسكاربامويليز ، مجال α- سبيكترين SH3 ، ال الإشريكية القولونية بروتين DsbA ، بروتين الريبوسوم S6 و عصية β-جلوكاناز [18 ، 19]. أشارت النتائج إلى أن البنية ثلاثية الأبعاد تبدو غير حساسة بشكل ملحوظ لـ CP [6] وتحتفظ CPs عمومًا بوظائفها البيولوجية [3 ، 4] ، على الرغم من أن الثباتات الهيكلية أو النوى القابلة للطي أو الحالات الانتقالية أو المسارات قد تتغير [18 ، 20 ، 21]. نظرًا لأن CP بشكل عام يحافظ على بنية البروتين ووظيفته ، مع زيادة الاستقرار أو النشاط في بعض الأحيان ، فقد تم تطبيقه لتحفيز التبلور [22] ، وتحسين أنشطة الإنزيم [15] ، وتحديد العناصر الحرجة [23 ، 24] ، وإنشاء بروتينات اندماج جديدة ، المواقع المربوطة التي لا تقتصر على الطرف الأصلي [25-28] ، مثل مستشعر الكالسيوم الفلوري الشهير [28].

على الرغم من هذه الخصائص والتطبيقات المثيرة للاهتمام ، لا يزال هناك الكثير من عدم اليقين بشأن الآليات الجينية ، والأهمية التطورية والانتشار الطبيعي للإنتاج الأنظف [6 ، 18 ، 29 ، 30]. يمكن أن تنشأ CPs من تعديلات ما بعد الترجمة [5 ، 31] ولكن قد تنشأ الغالبية من الأحداث الجينية [29]. كانت هناك العديد من الآليات الجينية والتطورية المقترحة ، على سبيل المثال ، نماذج الازدواج / الحذف [6 ، 32] ، ونماذج الازدواج عن طريق التقليب [1 ، 33] ، ونماذج الاندماج / الانشطار [2 ، 30] ، ونماذج البلازميد. قص ولصق '[10]. ومع ذلك ، ما الذي يلعب الدور الرئيسي أو النسبة التي تساهم بها كل آلية في تطور CPs وعائلات البروتين يبقى غير مؤكد. علاوة على ذلك ، بسبب الخلاف بين تعريفات CPs ، يمكن ملاحظة الاستنتاجات المتضاربة. بشكل عام ، الدراسات السابقة التي اعتبرت البروتين الكامل كوحدة تخضع للإنتاج الأنظف خلصت إلى أن الإنتاج الأنظف نادر في الطبيعة [6 ، 14 ، 30] بينما أولئك الذين ينظرون إلى المجال على أنه الوحدة التي تخضع للإنتاج الأنظف ، اقترحوا أن يكون الإنتاج الأنظف متكررًا [1 ، 29 ، 34].

في عصر ما بعد الجينوم هذا ، تتزايد كمية بيانات بنية البروتين بشكل كبير ، وينبغي استخراج الكثير من المعلومات للكشف عن الانتشار الطبيعي والآلية التطورية للإنتاج الأنظف ، ومع ذلك ، لا تزال أدوات البحث عن CP نادرة جدًا. تمت الإشارة إلى أن طرق مقارنة التسلسل التقليدية متسلسلة خطيًا بطبيعتها وغير فعالة في تحديد CP [6 ، 35]. قد تحدد المقارنات الهيكلية ثلاثية الأبعاد المزيد من CPs ذات الصلة التطورية البعيدة [6] ومع ذلك ، فإن الطرق التقليدية مثل DALI [36] و CE [37] هي أيضًا غير فعالة بسبب طبيعتها المتسلسلة [34]. لاكتشاف CP ، فإن الطريقة الأكثر دقة هي استخدام خوارزمية تولد كل CPs الممكنة لبروتين واحد ثم تصطفها مع بروتين آخر للعثور على محاذاة أفضل من المحاذاة الخطية [2 ، 38] ، على الرغم من أن هذا يبدو وقتًا شديدًا للغاية- تستهلك. تم تطوير عدد قليل من الأساليب الرائعة لتحقيق كفاءة أعلى. أولييل وآخرون. [30 ، 38] اقترح طريقة إرشادية تعتمد على تكرار واحد من تسلسل البروتين متبوعًا بالتحقق اليدوي. على الرغم من كونها أسرع بكثير ، إلا أنها لا تزال تستغرق عدة أشهر لوحدة المعالجة المركزية لمسح عشرات الآلاف من التسلسلات. كما أن متطلبات الفحوصات اليدوية تجعل البحث في مجموعات البيانات الكبيرة أمرًا غير واقعي [2]. وينر وآخرون. [2] متواليات الأحماض الأمينية المكثفة في سلاسل مجال صغيرة لتحقيق سرعة عالية للغاية ، ومسح مئات الآلاف من المتواليات في ساعات ، ومع ذلك ، دون شروح المجال المناسبة أو عندما يعطل CP مجال ما ، تحدث سلبيات كاذبة. كما تم تطوير طرق المحاذاة الهيكلية التي تنطبق على تحديد CPs. على سبيل المثال ، قام Jung and Lee [29] بتطوير SHEBA لفحص قاعدة بيانات SCOP. اقترحوا أن CPs متكررة جدًا وأن العديد منها له هياكل متماثلة. ومع ذلك ، نظرًا لأن التناظر الداخلي قد يُدخل ضوضاء في اكتشاف CPs [39] ، يمكن إنتاج تنبؤات إيجابية خاطئة معينة. بغض النظر عن القدرة على اكتشاف CPs ذات الصلة البعيدة ، قد تستغرق المقارنة الزوجية بواسطة خوارزميات الكشف عن CP القائمة على الهيكل من ثوانٍ إلى دقائق [34] ، مما يجعل عمليات البحث الروتينية في قاعدة البيانات غير مجدية.

نظرة عامة على CPSARST

نقدم هنا CPSARST (بحث التقليب الدائري بمساعدة التحويل المتسلسل Ramachandran) ، وهي أداة فعالة للبحث عن CPs. يصف هياكل البروتين ثلاثية الأبعاد كسلاسل نصية أحادية البعد باستخدام خوارزمية راماشاندران للتحويل المتسلسل (RST) [40] ، والتي تحول هياكل البروتين من خلال خريطة راماشاندران (RM) التي يتم تنظيمها بواسطة تجميع أقرب الجيران. تعمل منهجية التشفير الخطي هذه على تحويل مشاكل المقارنة الهيكلية المعقدة والمستهلكة للوقت إلى مقارنات سلسلة يمكن إجراؤها بسرعة كبيرة. حققت CPSARST أيضًا كفاءة عالية من خلال تكرار بنية الاستعلام والعمل من خلال استراتيجية "التصفية المزدوجة والتحسين". هذه الأساليب موضحة في الشكل 1. تتوفر خدمة ويب وبرنامج Java مستقل من CPSARST على [41]. لا يرث CPSARST مزايا السرعة للطرق القائمة على التسلسل فحسب ، بل يحتفظ بالحساسية للكشف عن CPs ذات الصلة البعيدة والتي يمكن اكتشافها في الغالب فقط من خلال الأساليب القائمة على الهيكل. على حد علمنا ، إنها أول طريقة بحث عن التشابه الهيكلي تجعل عمليات البحث في قاعدة البيانات الشاملة مقابل كل شيء قابلة للتحقيق والعملية. نفترض أنه يمكن تطبيق هذا الإجراء للكشف عن الأهمية التطورية لـ CP واكتشاف العلاقات الهيكلية للبروتين الجديد. تم اكتشاف العديد من علاقات CP الجديدة بواسطة CPSARST وتم الإبلاغ عنها في هذه المقالة أيضًا ، تم إجراء بعض التقديرات المنطقية لانتشار CP في قواعد البيانات الهيكلية للبروتين عن طريق إجراء عمليات بحث شاملة في قاعدة البيانات لجميع بنك بيانات البروتين غير الزائد (PDB). ) و SCOP.

مخطط انسيابي لـ CPSARST. تستخدم CPSARST إستراتيجية "التصفية المزدوجة والتحسين" التي تجمع بين الفحص السريع وخطوة التحسين الدقيقة ، ولكل منها جولتان مختلفتان. في مرحلة الفرز ، يتم تحويل البنية ثلاثية الأبعاد لبروتين الاستعلام إلى سلسلة هيكلية أحادية البعد بواسطة خوارزمية RST [40]. تخضع سلسلة الاستعلام هذه لجولتين من عمليات البحث في قاعدة البيانات. في الجولة الأولى ، يتم البحث عنها مقابل قاعدة بيانات سلسلة هيكلية محولة مسبقًا بطريقة الكشف عن مجريات الأمور. في الجولة الثانية ، يتم تكرارها قبل البحث في قاعدة البيانات. نتائج الجولتين عبارة عن نتائج مفلترة مع درجات تشابه محسّنة بشكل هادف تعتبر مرشحة CP (باللون الأحمر). في مرحلة التنقيح ، يتم تحليل المرشحين بواسطة خوارزمية محاذاة هيكلية دقيقة ، FAST [63] ، مع وبدون معالجة CP ، لتحديد مصداقيتهم واسترداد مواقع التقليب بشكل أكثر دقة. بعد تصفية الحالات غير المحتملة ، يتم إخراج الإجابات النهائية بمعلومات مفصلة. المثال المستخدم في هذا الشكل هو حالة حقيقية مع قوائم نتائج مبسطة.


نتائج

نرغب في إيجاد علاقة رياضية بين (φ ، ψ) و (ρ ، ϑ) أنظمة الإحداثيات ، حيث (φ ، ψ) هي الزوايا ثنائية الأضلاع شائعة الاستخدام ، ρ هو عدد البقايا لكل دورة واحدة للحلزون α ، و ϑ هي الزاوية بين العمود الفقري الكربونيل (CO) الطبيعي للبقايا المعطاة بالنسبة إلى الوضع الطبيعي لاتجاه الحلزون (α) (ϑ موجب ل CO العادي يشير إلى الخارج من مركز الحلزون α) كما هو موضح في الشكل 1 أ. العلاقة بين ρ و ϑ ك وضيفة من (φ ، ψ) في الشكل 1 ج ود ، على التوالي. تم إجراء التحديد التحليلي لحوض α-helix باستخدام درجة محاذاة HB س، مثل تلك المناطق ذات س & GT 0 يتم التعامل معها على أنها حوض α-helix في هذه الدراسة. يوضح الشكل 1 ب النتيجة التي تم تقييمها س ك وضيفة من (φ ، ψ) ، ويعرض بصريًا شكل وموقع حوض α-helix. بعد ذلك ، استنتجنا تحولًا خطيًا من (φ ، ψ) إحداثيات إلى (ρ ، ϑ) ينسق مع مجموعة المعادلات التالية:

اشتقاق البديل (ρ ، ϑ) نظام إحداثيات لحوض α-helix.

(أ) تعريف ϑ زاوية: nح هو اتجاه الحلزون طبيعي و nكو هل الأكسجين الكربوني طبيعي ، ϑ تكون موجبة عندما نكو يشير إلى الخارج مركز اللولب والسالب خلاف ذلك. ذرات الأكسجين حمراء ، وذرات النيتروجين زرقاء ، وذرات الكربون سماوي. (ب) التحديد التحليلي لحوض α-helix بواسطة درجة محاذاة رابطة الهيدروجين (HB) س: لا محاذاة HB للمناطق ذات س = 0 والمحاذاة القصوى للمناطق ذات س = 1. تم العثور على أفضل محاذاة HB على القطر φ + ψ = −107.8° في (φم, ψم) = (−49.7°, −58.1°). (ج) عدد المخلفات المحسوب لكل دورة حلزون α واحدة للمناطق ذات س & GT 0. (د) الزاوية المحسوبة ϑ بين ثاني أكسيد الكربون العادي واللولب الطبيعي للمناطق ذات س & GT 0. الاعتماد الخطي التقريبي لـ (ρ ، ϑ) تشغيل (φ ، ψ) يمكن رؤيتها بوضوح في كلا (ج و د). (ه) درجة محاذاة HB لحوض α-helix على التقريب الخطي (ρ ، ϑ) نظام الإحداثيات. الشكل الأمثل لمحاذاة HB على (ρ ، ϑ) تم العثور على مساحة تقريبًا في ρ = 3.62 ± 0.2 [الدقة / بدوره] و ϑ = 1.1 ± 2.4°. الرسوم المتحركة PDB التي توضح التغيير في ρ و ϑ يمكن العثور على في α-helices في المواد التكميلية SM1_rho.pdb و SM2_theta.pdb ، على التوالي.

أين أخطاء ρ و ϑ هي Δρ & lt 0.2 [الدقة / بدوره] و Δϑ & lt 2.4° لـ س & GT 0. يعرض الشكل 1 هـ درجة المحاذاة س على الناتج (ρ ، ϑ) فضاء.

في هذه الدراسة ، نميز بين 400 من أزواج AA التي تحدث بشكل طبيعي والتي نسميها انتقالات. من خلال تسمية الأزواج على أنها انتقالات ، فإننا نؤكد في الواقع على أهمية الاتجاهية عند التعامل مع عديد الببتيدات. على ال (φ ، ψ) الفضاء والتشكيل الانتقالي هو (φ ، ψ) زوج يصف تشكيل الانتقال من AAX إلى AAص. للانتقال يتقدم من الطرف N إلى C مع ذرات العمود الفقري التالية: NX-CαXXص-Cαصصنحدد المرحلة الانتقالية ψ = ψX− & gtY ثنائي السطوح مثل N.X-CαXXص والانتقالية φ = φX− & gtY ثنائي السطوح مثل CXص-Cαصص. يتم استخدام اصطلاح التسمية هذا لوصف تشكيل العمود الفقري α-helix. يعرض الشكل 2 أ توزيع جميع انتقالات عينات ALA− و gtALA على (φ ، ψ) نظام الإحداثيات. من الواضح أن (φ ، ψ) التوزيع على طول φ + ψ = مقدار ثابت قطري ، وهو نتيجة HBs على طول العمود الفقري α-helix 14،21 والمناطق التي يتعذر الوصول إليها بشكل معقّم بالقرب من حوض α-helix 13،14. يعرض الشكل 2 ب التوزيع النموذجي لجميع انتقالات ALA− و gtALA التي تم أخذ عينات منها على (ρ ، ϑ) نظام الإحداثيات. من خلال مراقبة الشكل 2 ب ، نستنتج على الفور أن انتقالات ALA− و gtALA الموجودة في حلزونات PDB تحتوي على متوسط 3.6 [الدقة / بدوره] وأ ϑ زاوية من حوالي 12° بالنسبة لاتجاه الحلزون الطبيعي بالاتفاق مع التقارير السابقة 22،23،24،25. هذا الأخير هو التحقق من صحة (φ ، ψ إلى ρ ، ϑ) تم تطبيق التحويل على بيانات PDB ، المقدمة في المعادلة 1. توضح جميع التحولات الأخرى توزيعات مشابهة جدًا لتلك الخاصة بـ ALA− & gtALA باستثناء PRO و GLY التي ستتم مناقشتها لاحقًا في هذه الدراسة. يكمن الاختلاف بين التحولات المختلفة في القيمة المتوسطة للتوزيع المحدد. إحدى النتائج المثيرة للاهتمام المعروضة في الشكل 2 ب هي التقلبات المتماثلة الشبيهة بغوسيان في نظام الإحداثيات البديل. تقلبات القيم المقاسة ناتجة عن القياس والحرارة ومصادر الضوضاء الأخرى. يسمح نمط التذبذب المتماثل باستخلاص الاستنتاج التالي: بالتركيز على بعض الكفاف الدائري في الشكل 2 ب ، الأخضر على سبيل المثال ، نستنتج أن الطاقة تسبب تحولًا في

0.8 [الدقة / بدوره] هي نفس الطاقة لإحداث تحول في

15° من ϑ زاوية. ستتم مناقشة الآثار المترتبة على هذه الملاحظة في قسم التحولات غير المتجانسة.

(أ) التوزيع القطري النموذجي لتحولات Alanine- & gtAlanine في حلزونات ألفا على (φ ، ψ) نظام الإحداثيات. (ب) التوزيع النموذجي لـ Alanine- & gtAlanine على (ρ ، ϑ) نظام الإحداثيات. (ج) متوسط ​​قيم 400 انتقال ممكن من الأحماض الأمينية لمستويات التصفية الأربعة على (φ ، ψ) نظام الإحداثيات. يُظهر الشكل الداخلي الهجرة الخطية نحو الارتفاع φ القيم والمنخفضة ψ القيم مع مستوى التصفية المتزايد (النقاط الموجودة في الحامل الداخلي للقيمة المتوسطة الإجمالية عند مستوى التصفية المحدد). (د) القيم المتوسطة لـ 400 زوج انتقالي من B على (ρ ، ϑ) ينسق النظام على أربعة مستويات تصفية. تقدم الخطوط الخضراء حدود درجة محاذاة رابطة الهيدروجين لـ س = 0, 0.2, 0.4, 0.6، و 0.8. يوضح الشكل الداخلي الهجرة نحو المستوى المنخفض ϑ القيم وتقريباً لا يوجد تغيير لـ مع مستوى التصفية المتزايد (النقاط الموجودة في الإطار الداخلي تمثل القيمة المتوسطة الإجمالية عند مستوى التصفية المحدد). عينات (ج و د) وفقًا لمستوى التصفية: الدوائر الخضراء للمستوى 0 ، والماس الأزرق للمستوى 1 ، والعلامات النجمية السوداء للمستوى 2 ، والنجوم الحمراء للمستوى 3.

يتم عرض القيمة المتوسطة لكل من 400 انتقال طبيعي في الشكل 2 ج لكل مستوى من مستويات الترشيح الأربعة. يوضح الشكل الداخلي 2 ج القيمة المتوسطة لكل هذه الانتقالات لمستوى الترشيح المحدد. نلاحظ بوضوح هجرة المرحلة الانتقالية (φ ، ψ) أزواج نحو الأعلى φ القيم وأقل ψ القيم على طول φ + ψ = مقدار ثابت قطري ، مما يشير إلى أنه بالنسبة إلى الحلزونات ذات HBs المحاذاة بشكل أفضل ، يجب أن نتوقع ارتفاعًا أعلى φ القيم وأقل ψ القيم. هذا يثير التساؤل عن مقدار الزيادة φ وتنقص ψ على طول φ + ψ = مقدار ثابت قطري بحيث يبقى عديد الببتيد في شكله الحلزوني ألفا. تم العثور على الإجابة في المعادلة 3 (في الطرق) التي توضح أن أفضل معادلة محاذاة HB موجود على السطر φ + ψ = −107.8° في (φم, ψم) = (−49.7°, −58.1°). يعرض الشكل 2 د نفس التحولات كما في الشكل 2 ج ولكن على (ρ ، ϑ) نظام الإحداثيات. لوحظ انتقال واضح نحو المناطق ذات درجة المحاذاة العالية مع زيادة مستوى التصفية. علاوة على ذلك ، لوحظ تغيير ضعيف للغاية من مستوى التصفية 2 والمستوى 3 مما يشير إلى أن تشابه HB المحاذي إلى أقصى حد عند (ρ ، ϑ)

(3.62 [الدقة / بدوره], 0°) يصعب الوصول إليه. في الشكل 3 نوضح أن أفضل توافق لـ (ρ ، ϑ) = (3.63 [الدقة / بدوره], 9.3°) نتيجة مباشرة لتفاعلات HB بترتيب 4 [كيلو كالوري / مول].بعد الحصول على توزيعات 400 من التحولات التي تحدث بشكل طبيعي ، نقسم التحليل إلى جزأين: 20 متجانسة (نفس AAs) و 380 تحليل انتقالي غير متجانسة (AAs مختلفة).

دور تفاعلات رابطة الهيدروجين (HBI) في تحديد التشكل الأمثل للعمود الفقري α-helix.

(أ) بدون HBI ، يمكن العثور على التشكل الأمثل عند ρ = 4.35 [الدقة / بدوره] و ϑ = 28.7°. يتم تحديد التشكل الأمثل في هذه الحالة من خلال تفاعلات van der Waals steric. (ب) إدراج ضعف HBI بمقادير تصل إلى هHB = 2 [كيلو كالوري / مول] لا تُظهر تحولًا كبيرًا في التشكل الأمثل وتبقى عند ρ = 4.35 [الدقة / بدوره] و ϑ = 28.7°. (ج) إدراج HBI بحجم هHB = 3 [كيلو كالوري / مول] تحويل التشكل الأمثل إلى ρ = 3.65 [الدقة / بدوره] و ϑ = 10.9°. (د) إدراج HBI بحجم هHB = 4 [كيلو كالوري / مول] تحويل التشكل الأمثل إلى ρ = 3.63 [الدقة / بدوره] و ϑ = 9.3°. وفقًا للأدبيات ، فإن مقادير HBI الشائعة للعمود الفقري α-helix هي من 2 [كيلو كالوري / مول] إلى 6 [كيلو كالوري / مول]. القيمة المتوسطة لـ هHB = 4 [كيلو كالوري / مول] يتنبأ بأن التشكل الأمثل موجود ρ = 3.63 [الدقة / بدوره] و ϑ = 9.3° للعمود الفقري α-helix. بسبب الاختلاف الكبير بين القيم القصوى والحد الأدنى للطاقة ، فإن الدالة اللوغاريتمية لسجل النموذج (1 + (تسجيل (1 + ه))) تم تطبيقه على جميع قيم الطاقة الناتجة للسماح بتصور أفضل لخرائط الطاقة.

انتقالات متجانسة

يعرض الشكل 4 المتوسط ​​(ρ ، ϑ) قيم 20 انتقالًا متجانسًا ممكنًا على مستويات التصفية الأربعة ، فكلما ارتفع المستوى كان محاذاة العمود الفقري للحلزون بشكل أفضل. يُعرف MALEK باسم AAs مع أعلى ميول حلزونية 20 ، وكما يمكن ملاحظته بالفعل في الشكل 4 ، فإن MALEK منتشر عن كثب حول مركز كل مستوى ترشيح ، خاصةً في تصفية المستوى 0 والمستوى 1. وهذا يشير إلى أن MALEK تم محاذاة AAs حلزونية بشكل جيد وتملي عمليا موقع التشكل اللولبي المتوسط. من الواضح أن انتقالات GLY هي دائمًا أقصى اليسار مع أقل كمية من البقايا لكل منعطف وأن انتقالات PRO تكون دائمًا في الأسفل مع أدنى ϑ. لدى GLY و PRO ميل واضح للابتعاد عن السلوك الحلزوني المتوسط ​​العام (والذي يُشار إليه بالرمز + في كل قطعة أرض) ، ربما بسبب التكلفة العالية للطاقة لتضمين GLY و PRO داخل α-helices 19،20. ومع ذلك ، يختلف GLY و PRO في تأثيرهما المحلي على هندسة اللولب. يقلل GLY بشدة من عدد البقايا لكل دور ويحافظ عليه ϑ أعلى من المتوسط ​​العام كما هو ملاحظ في جميع مستويات التصفية. من ناحية أخرى ، يحافظ PRO على عدد البقايا لكل دور أعلى من المتوسط ​​العام وينخفض ​​بشدة ϑ، كما لوحظ في جميع مستويات التصفية.

انتقالات متجانسة لمستويات التصفية الأربعة.

توضع أكواد الأحماض الأمينية أحادية الحرف (AA) على متوسط ​​التشكل المحسوب. يتم تلوين الحروف وفقًا لمجموعة AA: أخضر للقطبي غير المشحون ، والأحمر للحمضية ، والأزرق للأساس ، والأسود للكارهة للماء ، والأرجواني للخاص. يتم وضع رموز الأسود + على متوسط ​​التشكل العام لكل مستوى ترشيح. تتميز مستويات التصفية الأربعة بمستويات متزايدة من الترتيب ، حيث يكون ترشيح المستوى 0 هو الأقل ترتيبًا وقد يتضمن حتى المطابقات غير الحلزونية. يتضمن ترشيح المستوى 1 مناطق حلزونية ألفا فقط ولكن مع وجود مكامن الخلل المحتملة وأنواع أخرى من التشوهات. يتضمن ترشيح المستوى 2 مجموعة فرعية من المطابقة التي يجب أن تفي بمعيار محاذاة رابطة الهيدروجين (HB) مع عتبة ضعيفة. ترشيح المستوى 3 هو معيار الترشيح الأكثر طلبًا مع عتبة محاذاة HB قوية. MALEK هي AAs ذات الميل الحلزوني الأعلى وتنتشر عن كثب حول مركز كل مستوى ترشيح ، خاصة في مستوى التصفية 0 والمستوى 1. تشتهر G و P بميلها الحلزوني المنخفض وتظهر ميلًا واضحًا للابتعاد عن بشكل عام يعني السلوك الحلزوني.

ومن المثير للاهتمام ، أن AAs ARG (R) و LYS (K) الأساسية تُظهر سلوكًا توافقيًا قريبًا جدًا من متوسط ​​التشكل العام في جميع مستويات التصفية. يوضح AA HIS الأساسي ، أكبر كمية من المخلفات لكل دورة بين جميع AAs الأساسية والميل للبقاء فوق متوسط ​​الكمية الإجمالية للمخلفات لكل دورة في جميع مستويات الترشيح. وبالمثل ، فإن القطبية غير المشحونة AAs SER و THR و GLN (Q) دائمًا ما تحتوي على مخلفات أقل لكل دور من المتوسط ​​العام ، في حين أن كمية المخلفات لكل دور لـ ASN (N) دائمًا أعلى من المتوسط ​​العام.

يظهر كل من ILE و VAL ميلًا قويًا للانخفاض ϑ. هذه AAs هي البقايا الوحيدة التي تحتوي على كربونين في γ الموقف ، الأمر الذي يثير التساؤل عما إذا كانت هي سبب الانخفاض الملحوظ ϑ زاوية. لتأكيد هذه الفرضية ، أجرينا المحاكاة المفاهيمية 1 و 2 كما هو موضح في قسم الأساليب والموضحة في الشكل 5. تظهر نتائج البقايا الافتراضية المتضخمة في الشكل 5 أ أن الحجم بالقرب من العمود الفقري الحلزون ينخفض ​​بشدة ϑ وكذلك تنقص ρ. وبالتالي ، قد نستنتج أنه نظرًا لأن VAL أقل حجمًا من ILE ، فإنه يتناقص ϑ أقل كما تنبأت المحاكاة المفاهيمية.

رسم توضيحي للمحاكاة المفاهيمية الأربعة والتأثيرات الناتجة على التشكل الحلزوني.

(أ) المحاكاة المفاهيمية 1: ينتج عن المخلفات مع زيادة الحجم بالقرب من العمود الفقري انخفاض قوي في كليهما ϑ و ρ. (ب) المحاكاة المفاهيمية 2: ينتج عن المخلفات ذات الكثافة المتزايدة بعيدًا عن العمود الفقري انخفاض بمقدار ρ وانخفاض ضئيل في ϑ. (ج) المحاكاة المفاهيمية 3: ينتج عن المجال الكهربائي المطبق خارجيًا زيادة في ϑ يتناسب مع حجم المجال الكهربائي. (د) المحاكاة المفاهيمية 4: تؤدي قوة التمدد المطبقة خارجيًا إلى زيادة ρ تتناسب مع حجم القوة المطبقة. تمثل الأسطوانات السماوية العمود الفقري α-helix. يتم عرض قيمة نصف قطر vdW (σ) في Ångströms على قطع الأرض أ و ب وزاد من 3.5 أ إلى 9.5 أ في خطوات 0.5 أ. طول الرابطة د تم ضبطه على 1.54 أ في المحاكاة المفاهيمية 1 ، وتم الاحتفاظ بها عند σ 1.96 أ في المحاكاة المفاهيمية 2.

THR هو AA قطبي وغير مشحون ويختلف عن VAL بواسطة ذرة الأكسجين الموجودة على γ الموقف ، وإلا فإن VAL و THR متشابهان جدًا من الناحية الإجرامية وقد يُتوقع أن يتصرفوا بشكل مشابه. كما يمكن ملاحظته في الشكل 4 ، يظهر THR أقل بكثير ϑ زاوية من AAs الأخرى غير المشحونة (SER و ASN (N) و GLN (Q)) في جميع مستويات الترشيح ، باستثناء GLN (Q) في المستوى 0. وقد يكون السبب الأخير هو أن المستوى 0 قد يحتوي على non-α - المطابقات الحلزونية ، وبسبب الطبيعة القطبية لبقايا THR و GLN (Q). تشير التقارير السابقة إلى أن البقايا الضخمة تثبت α-helix HBs وتحميها من جزيئات الماء المحيطة 23،25. تؤكد ملاحظاتنا حول الضخامة في محيط العمود الفقري لـ ILE و VAL وفي بعض الحالات لـ THR أن حماية العمود الفقري α-helix يحدث عن طريق تقليل ϑ، منذ زيادة قيم ϑ تشير إلى وجود جزيئات الماء القريبة التي تزعزع استقرار α-helical HBs 22. يمكن تفسير استثناءات THR في المرشحات السفلية بطبيعتها القطبية.

تشير نتائج المحاكاة المفاهيمية 2 التي تركز على تأثير زيادة مسافة البقايا الافتراضية ، المعروضة في الشكل 5 ب ، إلى عدم حدوث أي تغييرات توافق تقريبًا عندما يتم تضخيم البقايا إلى القيمة الحرجة σج = 6 أ. فوق σج نلاحظ انخفاضًا في عدد المخلفات لكل دور ϑ لا يزال ثابتًا تقريبًا. من خلال التركيز على أكثر AAs ضخمة PHE (F) و TYR (Y) و TRP (W) (بترتيب متزايد من الضخامة ، على التوالي) في الشكل 4 ، نلاحظ بالفعل انخفاضًا في كمية المخلفات لكل دور مع الزيادة من الضخامة ، كما تؤكده المحاكاة المفاهيمية. بالإضافة إلى ذلك ، هناك نوعان من عدم التطابق واضحين: (1) من المتوقع أن تكون السنة المالية الدولية على يسار MALEK ولكن تمت ملاحظتها مع زيادة ρ (المنقولة إلى اليمين في الشكل 4) ، و (2) من المتوقع أن يظهر FYW انخفاضًا طفيفًا بمقدار ϑ مع زيادة الضخامة ولكنه يدل على زيادة ϑ مع زيادة الضخامة. قد يكون سبب عدم التطابق الملحوظ هو الطبيعة الساذجة للمحاكاة المفاهيمية التي تم إجراؤها والتي لا تأخذ في الحسبان التفاعلات الأخرى غير المجهرية.

نظرًا لأن α-helices ليست هياكل معزولة وربما تتفاعل مع البيئة المحيطة ، فقد أجرينا عمليتي محاكاة إضافيتين لفهم اعتماد الهيكل الحلزوني على القوى المحيطة. على المستوى الذري ، قد تحدث الجسيمات المشحونة تأثيرات محلية مشابهة لتلك المطبقة بواسطة مجال كهربائي 26،27،28. وهكذا ، قمنا باختبار تأثير المجال الكهربائي المطبق كما هو موضح في الشكل 5 ج. كما لوحظ بوضوح من المؤامرة الناتجة ، فإن المجال الكهربائي يشجع على تغيير ϑ، ولها تأثير ضئيل على كمية المخلفات لكل دور ، أو حرفيا التغيير في ϑ يتناسب مع حجم المجال الكهربائي المطبق. التغيير الصغير ولكن لا يزال موجودًا في ρ يرجع المحور إلى الكميات غير المتكافئة من الشحنات الجزئية لأكسجين الكربونيل (-0.5) وأميد الهيدروجين (+0.33). بالنسبة للحالة الافتراضية حيث كانت كلتا الشحنتين الجزئيتين بنفس المقدار المطلق ، فإننا لا نتوقع أي اعتماد للجهد الكهربائي على ρ محور.

في المحاكاة الأخيرة الموضحة في الشكل 5 د ، قمنا بقياس مساهمة قوة التمدد الخارجية المطبقة فقط على Cα للعمود الفقري الحلزوني. تُظهر المؤامرة مساهمة قوة التمدد الخارجية في إجمالي الطاقة التوافقية للعمود الفقري α-helix. كما لوحظ بوضوح ، فإن قوى التمدد تشجع على تغيير عدد البقايا لكل دور مع تغيير ضئيل ϑ، أو التغيير في ρ يتناسب مع حجم القوة المطبقة خارجيًا. يُظهر السلوك المرصود عمليا عدم وجود تغيير في ϑ منذ التغيير في ϑ يؤدي إلى اختلال غير موات بقوة في HBs. في كلتا المحاكاة المفاهيمية 3 و 4 ، سيؤدي تغيير علامة المجال الكهربائي (اتجاه القوة المطبقة) إلى التغيير المعاكس تمامًا لـ ϑ (ρ).

انتقالات غير متجانسة

الانتقال غير المتجانس هو انتقال AA1- & gtAA2 حيث AA1 ≠ AA2 بإجمالي 380 تحولات غير متجانسة لـ 20 AAs المشتركة. فرضية Flory's الزوج المعزول (IPH) 29 والتي تبين أنها غير صحيحة بشكل عام 30،31،32،33 تنص على أن (φ ، ψ) الزوج مستقل عن جيرانه. ومن المثير للاهتمام ، أنه لم تتم مناقشة IPH بالتفصيل على وجه التحديد لحوض α-helix ، ربما بسبب الصعوبات في التمييز بين حلزون وآخر. نهجنا في تحليل المطابقة على (ϑ ، ρ) يسمح الفضاء بدراسة الاختلافات حتى بين المطابقات الحلزونية α المتشابهة جدًا وسيتم استخدامه لاختبار صلاحية IPH لحوض α-helix. قبل الاقتراب من IPH ، سنركز على سؤال مهم آخر يرتبط ارتباطًا مباشرًا بـ IPH: هل يمكننا التنبؤ بالسلوك التوافقي لانتقال غير متجانس AA1- & gtAA2 من المتوسط ​​الحسابي للتحولات المتجانسة: AA1- & gtAA1 و AA2- & gtAA2؟ لإجراء المقارنة بين التشكل المقاس لبعض التشكل المتوقع ، نحسب التكلفة النشطة للتشكيل المتوقع بالنسبة للتشكيل المقاس. استنتجنا سابقًا أن الطاقة المطلوبة للتحول

0.8 [الدقة / بدوره] هي نفس الطاقة المطلوبة للتحول

15° من ϑ زاوية الكفاف الأخضر معروضة بصريًا في الشكل 2 ب. للعثور على قيم أكثر دقة للتحول ، كررنا الحساب الأخير ووجدنا أن 50٪ من جميع التحولات المقاسة محصورة داخلϑ، Δρ) ≈ (13.5, 0.8), (10.5, 0.6), (9.6, 0.6) و (8.7, 0.5) ، لمستويات التصفية الأربعة 0-3 ، على التوالي ، بمتوسط ​​(〈Δϑ〉 ، 〈Δρ〉) ≈ (10.6°, 0.63 [الدقة / بدوره]). الأساس المنطقي وراء هذا التوسط هو إعطاء وزن أكبر للهياكل الحلزونية الأكثر توافقًا (مستويات التصفية الأعلى). إذا حددنا وحدة طاقة واحدة (الاتحاد الأوروبي) كالطاقة المطلوبة لتحول Δϑ = 1° ونسبة التحويل ك = 〈Δϑ〉 / 〈Δρ〉 ≈ 16.8بدوره / الدقة] ، قد نستخدم تعبير الطاقة التوافقي التالي لتقريب طاقة بعض التشكل المعطى:

أين ϑ0 و ρ0 تمثل الحد الأدنى من تشكيل الطاقة لبعض عمليات الانتقال المعينة. منذ كلاهما 〈Δϑ〉 و 〈Δρ〉 هي متوسط ​​قيم الحبس لنصف التحولات المقاسة التي نستنتج أن طاقة الحدود للتحولات المحصورة هي ه0.5 = (〈Δϑ〉/2) 2 = ك 2 (〈Δρ〉/2) 228 [الاتحاد الأوروبي] ، وهي تقريبًا طاقة الكفاف الأخضر في الشكل 2 ب.

يعرض الجدول 1 فرق الطاقة بين المطابقات المقاسة للمطابقة المتوقعة للتحولات غير المتجانسة لتصفية المستوى 1 (يمكن العثور على جداول المستويات الأخرى في المعلومات الداعمة). تم توقع المطابقة من خلال حساب المتوسط ​​الحسابي للتوافق المتجانسة. تم حساب فروق الطاقة باستخدام المعادلة 2 ، من خلال تحديد التشكل المقاس على أنه الحد الأدنى من تشكّل الطاقة. تشير النتائج إلى أن متوسط ​​فرق الطاقة لجميع الحالات هو

3 [الاتحاد الأوروبي] ، أن أعلى اختلافات في الطاقة لوحظت للتحولات من PRO (AAطليعة- & gtAAX) وإلى PRO (AAX− & GTAAطليعة) ، وأنه في معظم الحالات تحمل التحولات طبيعة غير متماثلة ، أي ΔهAA1- & GTAA2 ΔهAA2- & GTAA1. قضية عدم التناسق كافية لاستنتاج أنه في معظم الحالات ستختلف المطابقة المتوقعة عن المطابقة الحقيقية. ومع ذلك ، إذا كانت اختلافات الطاقة مقبولة ، فقد يكون التنبؤ بالتوافقات غير المتجانسة مفيدًا في بعض الأحيان خاصة عند استبعاد PRO. في حالة ضبط التسامح على قيمة صغيرة جدًا 1 [الاتحاد الأوروبي] وجدنا أن 45٪ (171 انتقالية من 380) من التحولات غير المتجانسة يمكن التنبؤ بها عن طريق حساب متوسط ​​متجانس ، وفي حالة ضبط التسامح على نصف طاقة حدود السكان ه0.5 = 28 [الاتحاد الأوروبي], 97يمكن التنبؤ بنسبة (375 من 380) من التحولات غير المتجانسة عن طريق المتوسط ​​المتجانس. إذا كان IPH صحيحًا تمامًا مما نتوقع أن جميع القيم الواردة في الجدول 1 ستساوي 0. الجدول 1 هو في الواقع دليل على أن IPH غير صحيح عندما لا يُسمح بالتسامح في فرق الطاقة ، ولكن عند تقديم مثل هذا التسامح ، يصبح IPH 45% صحيح ل 1 [الاتحاد الأوروبي] التسامح و 97٪ صحيح ل 28 [الاتحاد الأوروبي] (وهي تقريبًا طاقة الكفاف الأخضر في الشكل 2) التفاوت المسموح به كما هو موضح أعلاه لترشيح المستوى 1 (تزداد النسب المئوية مع زيادة الترشيح). بالإضافة إلى ذلك ، فإن الطبيعة غير المتماثلة للتحولات تبرر نهج التحليل الانتقالي الذي تم إجراؤه في هذه الدراسة وتؤكد أن الجهود السابقة لتحليل المطابقات الحلزونية ألفا تفتقر إلى معلومات انتقالية مهمة.

التفسير المحتمل للانحراف الملحوظ بين التحولات غير المتجانسة لمتوسطها المتجانس هو التفاعل بين المخلفات - البقايا التي لا تتفاعل كيميائيًا أو معقدًا أو بأي طريقة أخرى يُتوقع أن تُظهر سلوكًا توافقيًا عشوائيًا ، أي متوسط ​​التشكل لاثنين غير من المتوقع أن تكون AAs المتفاعلة مساوية للتشكيل غير المتجانس المرصود. وبالتالي ، يمكننا أن نستنتج أنه كلما زاد فرق الطاقة بين التشكل غير المتجانس إلى المتوسط ​​المتجانس ، زاد التفاعل بين المخلفات باستثناء PRO الذي قد يؤدي إلى انحرافات عالية بسبب درجات الحرية المحدودة.


محتويات

هناك أربعة مستويات متميزة من بنية البروتين.

تحرير الهيكل الأساسي

يشير الهيكل الأساسي للبروتين إلى تسلسل الأحماض الأمينية في سلسلة البولي ببتيد. يتم تثبيت الهيكل الأساسي معًا بواسطة روابط الببتيد التي يتم إجراؤها أثناء عملية التخليق الحيوي للبروتين. يشار إلى طرفي سلسلة البولي ببتيد باسم الطرف الكربوكسيل (C-terminus) والنهاية الأمينية (N-terminus) بناءً على طبيعة المجموعة الحرة على كل طرف. يبدأ عد المخلفات دائمًا عند الطرف N (NH2-group) ، وهي النهاية التي لا تشارك فيها المجموعة الأمينية في رابطة الببتيد. يتم تحديد التركيب الأساسي للبروتين عن طريق الجين المقابل للبروتين. يتم نسخ تسلسل محدد من النيوكليوتيدات في الحمض النووي إلى mRNA ، والذي يقرأه الريبوسوم في عملية تسمى الترجمة. تم اكتشاف تسلسل الأحماض الأمينية في الأنسولين بواسطة فريدريك سانجر ، مما يثبت أن البروتينات لها تسلسل محدد للأحماض الأمينية. [3] [4] يعتبر تسلسل البروتين فريدًا بالنسبة لهذا البروتين ، ويحدد بنية ووظيفة البروتين. يمكن تحديد تسلسل البروتين بطرق مثل تدهور Edman أو قياس الطيف الكتلي الترادفي. ومع ذلك ، في كثير من الأحيان ، يتم قراءتها مباشرة من تسلسل الجين باستخدام الشفرة الجينية. يوصى بشدة باستخدام عبارة "بقايا الأحماض الأمينية" عند مناقشة البروتينات لأنه عند تكوين رابطة الببتيد ، يتم فقد جزيء الماء ، وبالتالي تتكون البروتينات من بقايا الأحماض الأمينية. عادةً ما تُعتبر التعديلات اللاحقة للترجمة مثل الفسفرة والجليكوزيلات جزءًا من الهيكل الأساسي ، ولا يمكن قراءتها من الجين. على سبيل المثال ، يتكون الأنسولين من 51 حمض أميني في سلسلتين. سلسلة واحدة بها 31 حمض أميني ، والآخر يحتوي على 20 حمضًا أمينيًا.

تعديل الهيكل الثانوي

يشير الهيكل الثانوي إلى الهياكل الفرعية المحلية المنتظمة للغاية في سلسلة العمود الفقري الفعلية متعددة الببتيد. تم اقتراح نوعين رئيسيين من البنية الثانوية ، الحلزون α و-strand أو ، في عام 1951 بواسطة Linus Pauling et al. [5] يتم تحديد هذه الهياكل الثانوية من خلال أنماط الروابط الهيدروجينية بين مجموعات الببتيد ذات السلسلة الرئيسية. لديهم هندسة منتظمة ، مقيدة بقيم محددة للزوايا ثنائية الأضلاع ψ و على مخطط راماشاندران. يمثل كل من α-helix و-sheet طريقة لإشباع جميع المتبرعين والمقبلين لرابطة الهيدروجين في العمود الفقري للببتيد. يتم ترتيب بعض أجزاء البروتين ولكنها لا تشكل أي هياكل منتظمة. لا ينبغي الخلط بينها وبين الملف العشوائي ، سلسلة بولي ببتيد غير مطوية تفتقر إلى أي بنية ثلاثية الأبعاد ثابتة. قد تشكل العديد من الهياكل الثانوية المتسلسلة "وحدة فوق الثانوية". [6]

تحرير الهيكل الثالث

يشير الهيكل الثلاثي إلى الهيكل ثلاثي الأبعاد الذي تم إنشاؤه بواسطة جزيء بروتين واحد (سلسلة عديد ببتيد واحدة). قد يتضمن مجالًا واحدًا أو أكثر. يتم طي صفائح α-helixes و-pleats في هيكل كروي مضغوط. الطي مدفوع بـ غير محدد التفاعلات الكارهة للماء ، دفن المخلفات الكارهة للماء من الماء ، لكن الهيكل مستقر فقط عندما يتم قفل أجزاء مجال البروتين في مكانها بواسطة محدد التفاعلات الثلاثية ، مثل جسور الملح ، والروابط الهيدروجينية ، والتعبئة الضيقة للسلاسل الجانبية وروابط ثاني كبريتيد. روابط ثاني كبريتيد نادرة للغاية في بروتينات العصارة الخلوية ، لأن العصارة الخلوية (السائل داخل الخلايا) هي بيئة مختزلة بشكل عام.

الهيكل الرباعي تحرير

الهيكل الرباعي هو هيكل ثلاثي الأبعاد يتكون من تجميع اثنين أو أكثر من سلاسل البولي ببتيد الفردية (الوحدات الفرعية) التي تعمل كوحدة وظيفية واحدة (متعددة). يتم تثبيت المولد المتعدد الناتج عن طريق نفس التفاعلات غير التساهمية وروابط ثاني كبريتيد كما هو الحال في البنية الثلاثية. هناك العديد من المنظمات الهيكلية الرباعية المحتملة. [7] تسمى المجمعات المكونة من اثنين أو أكثر من عديد الببتيدات (أي وحدات فرعية متعددة) متعددة الممرات. على وجه التحديد ، يمكن أن يطلق عليه dimer إذا كان يحتوي على وحدتين فرعيتين ، و trimer إذا كان يحتوي على ثلاث وحدات فرعية ، و tetramer إذا كان يحتوي على أربع وحدات فرعية ، و pentamer إذا كان يحتوي على خمس وحدات فرعية. غالبًا ما ترتبط الوحدات الفرعية ببعضها البعض من خلال عمليات التناظر ، مثل محور ثنائي الطي في ثنائي الملمس. تتم الإشارة إلى المضاعفات المكونة من وحدات فرعية متطابقة ببادئة "homo-" ويتم الإشارة إلى تلك المكونة من وحدات فرعية مختلفة ببادئة "hetero-" ، على سبيل المثال ، heterotetramer ، مثل جهازي alpha و two beta سلاسل الهيموجلوبين.

كثيرا ما توصف البروتينات بأنها تتكون من عدة وحدات هيكلية. تتضمن هذه الوحدات المجالات والزخارف والطيات. على الرغم من حقيقة أن هناك حوالي 100000 بروتين مختلف معبر عنه في الأنظمة حقيقية النواة ، إلا أن هناك عددًا أقل من المجالات المختلفة والزخارف الهيكلية والطيات.

تحرير المجال الهيكلي

المجال الهيكلي هو عنصر من عناصر البنية العامة للبروتين الذي يستقر ذاتيًا وغالبًا ما يطوي بشكل مستقل عن بقية سلسلة البروتين. العديد من المجالات ليست فريدة من نوعها لمنتجات البروتين لجين واحد أو عائلة جين واحدة ولكنها تظهر بدلاً من ذلك في مجموعة متنوعة من البروتينات. غالبًا ما يتم تسمية المجالات وتفردها لأنها تظهر بشكل بارز في الوظيفة البيولوجية للبروتين الذي تنتمي إليه ، على سبيل المثال ، "مجال ربط الكالسيوم بالكالموديولين". نظرًا لأنها مستقرة بشكل مستقل ، يمكن "تبديل" المجالات عن طريق الهندسة الوراثية بين بروتين وآخر لصنع بروتينات الكيميرا. مجموعة محافظة من عدة مجالات تحدث في بروتينات مختلفة ، مثل مجال البروتين التيروزين الفوسفاتيز وزوج مجال C2 ، كان يسمى "النطاق الفائق" الذي قد يتطور كوحدة واحدة. [8]

تحرير الزخارف الهيكلية والمتسلسلة

تشير الأشكال الهيكلية والمتسلسلة إلى أجزاء قصيرة من بنية البروتين ثلاثية الأبعاد أو تسلسل الأحماض الأمينية التي تم العثور عليها في عدد كبير من البروتينات المختلفة

تحرير البنية فوق الثانوية

يشير الهيكل الفائق الثانوي إلى مجموعة محددة من عناصر البنية الثانوية ، مثل وحدات β-α-β أو شكل حلزوني دوار. يمكن أيضًا الإشارة إلى بعضها على أنها زخارف هيكلية.

تعديل طية البروتين

تشير طية البروتين إلى بنية البروتين العامة ، مثل الحزمة الحلزونية ، أو البرميل ، أو طيات روسمان أو "الطيات" المختلفة المتوفرة في قاعدة بيانات التصنيف الهيكلي للبروتينات. [9] المفهوم ذو الصلة هو طوبولوجيا البروتين.

البروتينات ليست كائنات ثابتة ، بل هي عبارة عن مجموعات من الحالات التوافقية. تحدث التحولات بين هذه الحالات عادةً على المقاييس النانوية ، وقد تم ربطها بظواهر ذات صلة وظيفيًا مثل الإشارات الخيفية [10] وتحفيز الإنزيم. [11] تسمح ديناميكيات البروتين والتغيرات التوافقية للبروتينات بالعمل كآلات بيولوجية نانوية داخل الخلايا ، غالبًا في شكل مجمعات متعددة البروتينات. [12] تشمل الأمثلة البروتينات الحركية ، مثل الميوسين ، المسؤول عن تقلص العضلات ، والكينيسين ، الذي ينقل البضائع داخل الخلايا بعيدًا عن النواة على طول الأنابيب الدقيقة ، والداينين ​​، الذي يحرك البضائع داخل الخلايا باتجاه النواة وينتج الضرب المحوري للخلايا. أهداب متحركة وسوط. "[I] n تأثير ، [cilium المتحرك] عبارة عن آلة نانوية تتكون ربما من أكثر من 600 بروتين في مجمعات جزيئية ، يعمل العديد منها أيضًا بشكل مستقل كآلات نانوية. تسمح الروابط المرنة لمجالات البروتين المتنقلة المتصلة بها بتجنيد شركائها الملزمين و حث التباين بعيد المدى عبر ديناميكيات مجال البروتين. "[13]

غالبًا ما يُنظر إلى البروتينات على أنها هياكل من الدرجة الثالثة مستقرة نسبيًا تشهد تغيرات توافقية بعد تأثرها بالتفاعلات مع البروتينات الأخرى أو كجزء من النشاط الأنزيمي. ومع ذلك ، قد يكون للبروتينات درجات متفاوتة من الاستقرار ، وبعض المتغيرات الأقل استقرارًا هي بروتينات مضطربة جوهريًا. توجد هذه البروتينات وتعمل في حالة "مضطربة" نسبيًا تفتقر إلى بنية ثلاثية مستقرة. نتيجة لذلك ، يصعب وصفها ببنية واحدة من الدرجة الثالثة الثابتة. تم تصميم المجموعات التوافقية كطريقة لتوفير تمثيل أكثر دقة وديناميكية للحالة المطابقة للبروتينات المضطربة جوهريًا. [15] [14]

ملفات مجموعات البروتين هي تمثيل لبروتين يمكن اعتباره له بنية مرنة. يتطلب إنشاء هذه الملفات تحديد أي من مطابقة البروتين الممكنة نظريًا الموجودة بالفعل. تتمثل إحدى الطرق في تطبيق الخوارزميات الحسابية على بيانات البروتين لمحاولة تحديد مجموعة المطابقة الأكثر احتمالاً لملف المجموعة. هناك طرق متعددة لإعداد البيانات لقاعدة بيانات مجموعة البروتين التي تندرج في منهجيتين عامتين - مقاربتا الديناميكيات الجزيئية والتجمعية (مخططة في الشكل). يستخدم النهج القائم على التجمع تسلسل الأحماض الأمينية للبروتين لإنشاء مجموعة ضخمة من التوافقات العشوائية. ثم يخضع هذا التجمع لمزيد من المعالجة الحسابية التي تخلق مجموعة من المعلمات النظرية لكل تشكل على أساس الهيكل. المجموعات الفرعية التوافقية من هذا التجمع تم اختيار متوسط ​​المعلمات النظرية التي تتطابق بشكل وثيق مع البيانات التجريبية المعروفة لهذا البروتين. يأخذ نهج الديناميكيات الجزيئية البديلة العديد من المطابقات العشوائية في وقت واحد ويخضعها جميعًا لبيانات تجريبية. تعمل البيانات التجريبية هنا كقيود يجب وضعها على المطابقات (مثل المسافات المعروفة بين الذرات). يتم قبول المطابقات التي تمكنت من البقاء ضمن الحدود التي وضعتها البيانات التجريبية فقط. غالبًا ما يطبق هذا النهج كميات كبيرة من البيانات التجريبية على المطابقات وهي مهمة تتطلب الكثير من الناحية الحسابية. [14]

تم إنشاء المجموعات المطابقة لعدد من البروتينات عالية الديناميكية وغير المطوية جزئيًا ، مثل Sic1 / Cdc4 ، [16] p15 PAF ، [17] MKK7 ، [18] بيتا سينوكلين [19] و P27 [20]

كما يتم ترجمتها ، تخرج البولي ببتيدات من الريبوسوم في الغالب كملف عشوائي وتنطوي في حالتها الأصلية. [21] [22] يُفترض عمومًا أن يتم تحديد الهيكل النهائي لسلسلة البروتين من خلال تسلسل الأحماض الأمينية (عقيدة Anfinsen). [23]

يمثل الاستقرار الديناميكي الحراري للبروتينات فرق الطاقة الحرة بين حالات البروتين المطوية وغير المطوية. هذا الاختلاف في الطاقة الحرة حساس جدًا لدرجة الحرارة ، وبالتالي قد يؤدي التغيير في درجة الحرارة إلى التفتت أو التمسخ. قد يؤدي تمسخ البروتين إلى فقدان الوظيفة وفقدان الحالة الأصلية. عادة لا تتجاوز الطاقة الحرة لتثبيت البروتينات الكروية القابلة للذوبان 50 كيلو جول / مول. [ بحاجة لمصدر ] مع الأخذ في الاعتبار العدد الكبير من الروابط الهيدروجينية التي تحدث لتثبيت الهياكل الثانوية ، وتثبيت اللب الداخلي من خلال التفاعلات الكارهة للماء ، تظهر الطاقة الحرة للاستقرار كفرق صغير بين الأعداد الكبيرة. [24]

تم تحديد حوالي 90٪ من هياكل البروتين المتوفرة في بنك بيانات البروتين بواسطة التصوير البلوري بالأشعة السينية. [25] تسمح هذه الطريقة للفرد بقياس توزيع كثافة الإلكترونات ثلاثي الأبعاد (ثلاثي الأبعاد) في البروتين ، في حالة التبلور ، وبالتالي استنتاج الإحداثيات ثلاثية الأبعاد لجميع الذرات التي سيتم تحديدها بدقة معينة . تم الحصول على ما يقرب من 9٪ من تراكيب البروتين المعروفة بتقنيات الرنين المغناطيسي النووي (NMR). [ بحاجة لمصدر ] بالنسبة للمجمعات البروتينية الأكبر ، يمكن أن يحدد الفحص المجهري الإلكتروني بالتبريد هياكل البروتين. تكون الدقة عادةً أقل من دقة علم البلورات بالأشعة السينية ، أو NMR ، لكن الدقة القصوى تتزايد باطراد. لا تزال هذه التقنية ذات قيمة خاصة لمجمعات البروتين الكبيرة جدًا مثل بروتينات غلاف الفيروس وألياف الأميلويد.

يمكن تحديد التركيب العام للهيكل الثانوي عن طريق ازدواج اللون الدائري. يمكن أيضًا استخدام التحليل الطيفي الاهتزازي لتوصيف تشكيل الببتيدات والببتيدات والبروتينات. [26] أصبح التحليل الطيفي بالأشعة تحت الحمراء ثنائي الأبعاد طريقة قيمة لفحص هياكل الببتيدات والبروتينات المرنة التي لا يمكن دراستها بطرق أخرى. [27] [28] غالبًا ما يتم الحصول على صورة نوعية أكثر لبنية البروتين عن طريق التحلل البروتيني ، وهو مفيد أيضًا في فحص المزيد من عينات البروتين القابلة للتبلور. يمكن للتطبيقات الجديدة لهذا النهج ، بما في ذلك التحلل البروتيني المتوازي السريع (FASTpp) ، التحقق من الجزء المنظم واستقراره دون الحاجة إلى التنقية. [29] بمجرد تحديد بنية البروتين بشكل تجريبي ، يمكن إجراء المزيد من الدراسات التفصيلية حسابيا ، باستخدام المحاكاة الديناميكية الجزيئية لتلك البنية. [30]

قاعدة بيانات بنية البروتين هي قاعدة بيانات تم تصميمها حول هياكل البروتين المختلفة المحددة تجريبياً. الهدف من معظم قواعد بيانات بنية البروتين هو تنظيم وشرح هياكل البروتين ، مما يوفر للمجتمع البيولوجي إمكانية الوصول إلى البيانات التجريبية بطريقة مفيدة. غالبًا ما تتضمن البيانات المضمنة في قواعد بيانات بنية البروتين إحداثيات ثلاثية الأبعاد بالإضافة إلى معلومات تجريبية ، مثل أبعاد خلية الوحدة وزوايا الهياكل المحددة في علم البلورات بالأشعة السينية. على الرغم من أن معظم الحالات ، في هذه الحالة إما البروتينات أو تحديدات بنية معينة للبروتين ، تحتوي أيضًا على معلومات التسلسل وتوفر بعض قواعد البيانات حتى وسائل لإجراء الاستعلامات القائمة على التسلسل ، فإن السمة الأساسية لقاعدة بيانات الهيكل هي المعلومات الهيكلية ، بينما تركز قواعد بيانات التسلسل على معلومات التسلسل ، ولا تحتوي على معلومات هيكلية لغالبية الإدخالات. تعد قواعد بيانات بنية البروتين ضرورية للعديد من الجهود في مجال البيولوجيا الحسابية مثل تصميم الأدوية القائمة على الهيكل ، سواء في تطوير الأساليب الحسابية المستخدمة أو في توفير مجموعة بيانات تجريبية كبيرة تستخدمها بعض الطرق لتقديم رؤى حول وظيفة البروتين. [31]

يمكن تجميع هياكل البروتين بناءً على التشابه الهيكلي أو الطبقة الطوبولوجية أو الأصل التطوري المشترك. توفر قاعدة بيانات التصنيف البنيوي للبروتينات [32] وقاعدة بيانات CATH [33] تصنيفين بنيويين مختلفين للبروتينات. عندما يكون التشابه الهيكلي كبيرًا ، فمن المحتمل أن يكون البروتينان قد تباعدا عن سلف مشترك ، [34] وتعتبر البنية المشتركة بين البروتينات دليلًا على التماثل. يمكن بعد ذلك استخدام تشابه البنية لتجميع البروتينات معًا في عائلات بروتينية فائقة. [35] إذا كانت البنية المشتركة مهمة ولكن الجزء المشترك صغير ، فقد يكون الجزء المشترك نتيجة لحدث تطوري أكثر دراماتيكية مثل نقل الجينات الأفقي ، ولم يعد الانضمام إلى البروتينات التي تتقاسم هذه الأجزاء في عائلات البروتين الفائقة مبررًا. [34] يمكن استخدام طوبولوجيا البروتين لتصنيف البروتينات أيضًا. نظرية العقدة وطوبولوجيا الدائرة هما إطاران طوبولوجيا تم تطويرهما لتصنيف طيات البروتين بناءً على عبور السلسلة والتلامس داخل السلسلة على التوالي.

إن توليد تسلسل البروتين أسهل بكثير من تحديد بنية البروتين. ومع ذلك ، فإن بنية البروتين تعطي نظرة ثاقبة لوظيفة البروتين أكثر من تسلسله. لذلك ، تم تطوير عدد من الطرق للتنبؤ الحسابي لهيكل البروتين من تسلسله. [36] بداية تستخدم طرق التنبؤ فقط تسلسل البروتين. يمكن لطرق الخيوط والنمذجة المتجانسة بناء نموذج ثلاثي الأبعاد لبروتين ذي بنية غير معروفة من الهياكل التجريبية للبروتينات المرتبطة بالتطور ، والتي تسمى عائلة البروتين.


المواد والأساليب

المواد النباتية وظروف النمو

تم إجراء تجربة فحص أصناف نبات المونج التي تتحمل الجفاف باستخدام سبعة أصناف في أواني فخارية خلال الفترة من سبتمبر إلى ديسمبر 2014 في جامعة تيزبور ، الواقعة في منطقة سهل الضفة الشمالية في آسام (26 & # x000b014 & # x02032 و 92 & # x000b050 & # x02032) ، تيزبور ، الهند. لتجنب هطول الأمطار ، تم الاحتفاظ بالأواني الترابية تحت سقيفة مطر مؤقتة مبنية بغشاء بولي فينيل كلوريد (PVC) بسماكة حوالي 0.15 & # x02009 مم و 85٪ نفاذية. تم جمع بذور أصناف mungbean وهي PDM54 (V1) و PDM39 (V2) و IPM 99-125 (V3) و PDM11 (V4) و IPM 2-14 (V5) و IPM 2-3 (V6) من المعهد الهندي لـ Pulses Research (IIPR) ، كانبور ، الهند و Pratap (V7) من محطة البحوث الزراعية الإقليمية (RARS) ، ناجون ، آسام ، الهند. نفذت التجربة بتصميم القطاعات العشوائية الكاملة بأربعة مكررات. تم عمل الري المنتظم في محطات التحكم ، بينما تم سحب الري في النباتات المعالجة بعد 21 يومًا من الإنبات لمدة 10 أيام متتالية.

التحليلات الفسيولوجية والكيميائية الحيوية

تم إجراء تحليل لبعض سمات الواسمات الفسيولوجية والكيميائية الحيوية المعروفة بالفعل لتحمل الجفاف في الورقة الثانية من الأعلى خلال المرحلة الخضرية للمحصول. تم حساب محتوى الماء النسبي للأوراق في أوراق كل من النباتات الضابطة والنباتات المجهدة وفقًا للطريقة التي وصفها يانغ وآخرون. 38 بالصيغة التالية:

تم استخدام طريقة Anderson and Boardman & # x02019s 39 لتحديد محتوى الكلوروفيل الكلي في الأصناف. ثم تم حساب مؤشر استقرار الكلوروفيل (CSI) باستخدام الصيغة التالية:

تم تحديد محتوى البرولين الورقي باستخدام طريقة بيتس وآخرون. 40 وتم التعبير عنها كـ & # x003bcmol g & # x022121 الوزن الطازج. تم استخدام طريقة Jaworski 41 المعدلة لتحديد نشاط اختزال النترات. تم حساب مؤشر استقرار الغشاء (MSI) باستخدام طريقة مقدمة من قبل Premchandra وآخرون. 42 وبصيغته المعدلة بواسطة Sairam 43 باستخدام الصيغة:

تم استخدام طريقة أنثرون لاستخراج السكر الذائب وتم أخذ البقايا المتبقية بعد الاستخلاص الكحولي لاستخراج النشا وتم تقديرها بطريقة ماكريدي. وآخرون. 44 .

معالجات الإجهاد المائي وعزل الحمض النووي الريبي وتوصيف التعبير النصي

تم بعد ذلك إنبات البذور من أصناف الفاصوليا المتسامحة والمعرضة للإصابة في أواني مملوءة بطقوس التربة المُعقَّمة وتُروى بانتظام في غرفة نمو خاضعة للرقابة عند درجة حرارة 24 & # x02009 & # x000b0C في ICAR-National Research Center in Plant Biotechnology (NRCPB) ، Indian Agriculture Centre معهد البحوث (IARI) ، بوسا ، نيودلهي. تم الحفاظ على مجموعة أخرى من النباتات في وقت واحد حيث تم تقليص الري إلى نباتات mungbean التي يبلغ عمرها 21 يومًا لمدة عشرة أيام أخرى. للتحقق من تعبير SKP1 بغض النظر عن العلاجات والأصناف ، تم جمع عينات من الأوراق والسيقان والجذور والشتلات الكاملة في المرحلة الخضرية ، وتم تجميدها في النيتروجين السائل ثم تخزينها في & # x0221280 & # x02009 & # x000b0C لمزيد من الاستخدام.

عزل الحمض النووي الريبي

تم عزل RNA الكلي من الأوراق والساق والشتلات الكاملة باستخدام كاشف التريازول (Invitrogen ، Carlsbad ، الولايات المتحدة الأمريكية) ، بينما تم عزل RNA من الجذور باستخدام Spectrum kit (Sigma ، Mo ، الولايات المتحدة الأمريكية). تم فحص الحمض النووي الريبي المعزول مع صبغة تحميل الحمض النووي الريبي في هلام الاغاروز 1.2٪. 1 & # x02009 & # x003bcg من العينات تم بعد ذلك معالجة DNAse (Promega) بعد القياس الكمي الطيفي النانوي (Thermo Fisher Scientific ، Wilmington ، الولايات المتحدة الأمريكية).

النسخ العكسي شبه الكمي PCR

تم نسخ الحمض النووي الريبي المعالج DNAse عكسيًا باستخدام مجموعة توليف (كدنا) المرتفعة الثالثة (Invitrogen ، كارلسباد ، الولايات المتحدة الأمريكية). لكل تفاعل محدد ، تم استخدام 50 & # x02009ng من cDNA كقالب مع بادئات خاصة بالجينات للتضخيم ، مصممة من تسلسلات SKP1 المتاحة من قواعد البيانات العامة في NCBI (www.ncbi.nlm.nih.gov). تم بعد ذلك إجراء تفاعلات RT-PCR في حجم 50 & # x02009 & # x000b5l من خليط التفاعل الذي يحتوي على 1X مزيج رئيسي أخضر (Takara Bio Inc ، Shiga ، اليابان) و 10 & # x02009nM من كل تمهيدي أمامي وعكسي. تم تحضين التفاعل بالكامل في برنامج cycler الحراري للتمسخ الأولي عند 94 & # x02009 & # x000b0C لمدة 4 & # x02009 دقيقة متبوعة بـ 35 دورة من 94 & # x02009 & # x000b0C لمدة 45 ثانية تمسخ ، 61.4 & # x02009 & # x000b0C لمدة 45 ثانية التلدين ، 72 & # x02009 & # x000b0C لتمديد دقيقة واحدة وامتداد نهائي عند 72 & # x02009 & # x000b0C لمدة 10 & # x02009min (Biometra ، Goettingen ، ألمانيا). كانت تسلسل الاشعال المستخدمة (forward-5 & # x02032TGGCTGCCAACTACCTGAACA3 & # x02032 و reverse-5 & # x02032ACATGTTCACCGACACCACCT3 & # x02032) للتضخيم الجيني mungbean SKP1. تم تحديد مستوى التعبير النسبي للجينات المستهدفة بشكل شبه كمي باستخدام c-DNA المركب من الأوراق والجذور والجذور والشتلات الكاملة ، وفحصها في هلام بنسبة 1.2 ٪ وتم تحليلها بمساعدة برنامج Syngene ، وأدوات الجين (Syngene ، المملكة المتحدة). للتقدير الكمي ، تم مضاعفة كل عينة ثلاث مرات ثم تحليلها. تضخيم الأكتين (forward-5 & # x02032AGCGAGTCTTCATAGGGCGAT3 & # x02032 and reverse-5 & # x02032TAGCTCTGGTTCGAGTGGCA3& # x02032) كعنصر تحكم داخلي لضمان كميات متساوية من (كدنا) والتقدير النسبي.

استنساخ SKP1 ORF كامل الطول من mungbean

تم تضخيم ORF كامل الطول لـ SKP-1 من صنف mungbean Pratap ، باستخدام الاشعال إلى الأمام 5 & # x02032ACCACTGACCGAAGATGTTCACCA3 & # x02032- والعكس 5 & # x02032GAGCGATGGCGGCCGCGGGAGAC3 & # x02032. تم استنساخ التسلسل في ناقل pGMT ، وأكده المستعمرة PCR والهضم المقيد متبوعًا بتسلسل Senger (AgriGenom ، Cochin ، الهند). تم إجراء تجانس التسلسل باستخدام أدوات NCBI (www.ncbi.nlm.nih.gov) وتم التحقق منه وإيداعه في بنك الجينات. تم إجراء محاذاة تسلسل متعددة مع تسلسل الأحماض الأمينية SKP1 المتاحة للجمهور باستخدام Clustal omega (//www.ebi.ac.uk/Tools/msa/clustalo/). تم رسم شجرة النشوء والتطور باستخدام PhyFi (http://cgi-www.daimi.au.dk/cgi-chili/phyfi/go).

SKP1 آخر اسمه SKP1-1 (= 400 & # x02009bp) ، تم أيضًا تضخيم تسلسل الترميز باستخدام الاشعال إلى الأمام 5 & # x02032GGTCTAGAATGGCGCCGCGGGAG3 & # x02032 و reverse-5 & # x02032CGCGGATCCCTACTCAAAGGCC # 0 تم استنساخ التسلسل في ناقل pGMT ، وأكده المستعمرة PCR والهضم المقيد متبوعًا بتسلسل Senger (AgriGenom ، Cochin ، الهند).

نمذجة البروتين الجزيئي والتحسين الهيكلي

تعرض تسلسل النوكليوتيدات لجين VrSKP1 لأداة البحث عن المحاذاة المحلية الأساسية للنيوكليوتيدات (BLASTn) ، وقد وجد أنه مشابه بنسبة 100 ٪ مع مرنا لبروتين SKP1 المفترض من تي. aestivum (انضمام لا.<"type": "entrez-nucleotide"، "attrs": <"text": "AJ577364"، "term_id": "40644753"، "term_text": "AJ577364" >> AJ577364). لتأكيد الجين ، تم تقديم تسلسل النيوكليوتيدات إلى بنك بيانات NCBI (رقم المدخل <"type": "entrez-nucleotide" ، "attrs": <"text": "KX881912"، "term_id": "1095459840"، " term_text ":" KX881912 ">> KX881912). ثم تمت ترجمة التسلسل الجيني باستخدام أداة & # x0201cExpasy Translate & # x0201d لاستنتاج تسلسل البروتين. ثم انضمام لا. <"type": "entrez-protein"، "attrs": <"text": "APA16578.1"، "term_id": "1095459841"، "term_text": "APA16578.1" >> APA16578.1 من VrSKP1 تعرض البروتين لـ BLASTp باختيار خيار قاعدة البيانات كبروتينات بنك بيانات البروتين (PDB). تم أخذ تسلسل FASTA من أفضل 5 نتائج وإخضاعها لتحليل التسلسل المتعدد (MSA). الانضمام لا. من الضربات المعنية مذكورة في الشكل & # x000a0 6. تم إجراء MSA في MUSCLE 45 وتم استخدام ESPript3.0 46 لتفسير نتائج MSA. من أجل تحديد بنية البروتين ، تم تقديم تسلسل الأحماض الأمينية إلى ITASSER 47 لنمذجة البروتين. قامت شركة Molprobity 48 بالتحقق من صحة الهيكل النموذجي من خلال رسم مخطط Ramachandran Plot.

محاكاة الديناميات الجزيئية (MD)

تم إجراء محاكاة MD على الهيكل النموذجي للبروتين (VrSKP1) لمدة 180 نانوثانية. تم استخدام حزمة برامج Gromacs 5.1.4 49 مع مجال القوة OPLS-AA. تم بعد ذلك حل النظام بأكمله باستخدام نموذج ماء ذو ​​شحنة نقطية بسيطة (SPC) في صندوق مكعب وأضيف 16 Na + أيون مضاد لتحييد النظام. تم تخفيف النظام باستخدام خوارزمية النسب الأكثر انحدارًا بمقياس زمني قدره 1 فيمتوثانية. تم الحفاظ على درجة حرارة النظام عند 300 & # x02009K من خلال اقتران درجة الحرارة المتساوية ، والمحاكاة المتساوية المحددة بواسطة الكثافة (33.321 جزيء / نانومتر 3) لصندوق SPC النقي المرجعي (أي كثافة الماء السائل التجريبية عند حوالي 300 & # x02009K) استخدمنا لتقليد ظروف الماء السائل النموذجية لإدخال جزيء البروتين في المذيب ، يتوافق مع ظروف المحاكاة لدينا تقريبًا. 560 بار بدلا من التجريبية تقريبا. 1 بار 50. تم ضبط المسافة بين أقرب ذرات البروتين والجدار المائي & # x02019s على 1.4 & # x02009nm. باستخدام شروط الحدود الدورية ، تم إجراء 180 & # x02009ns من المحاكاة في المجموعة متساوي الحرارة (NVT) 51. تم تقييد جميع الروابط باستخدام خوارزمية LINCS 52 بنصف قطر قطع 1.3 & # x02009nm للتفاعل قصير المدى. تم استخدام طريقة Particle Mesh Ewald لحساب التفاعلات طويلة المدى مع البحث الشبكي وقطع نصف قطر 1.3 & # x02009nm. تم حساب محتوى الهيكل الثانوي على طول المسار وفقًا لخوارزمية DSSP 54. يتم تحليل المسار باستخدام برنامج Grace لتخطيط الرسوم البيانية RMSD ودرجة الحرارة والطاقة والضغط.

الديناميكيات الأساسية (ED) والمناظر الطبيعية ذات الطاقة الحرة (FEL)

لتوضيح الهيكل واستخراج حركات السعة الأكبر التي لوحظت في مسارات MD لـ VrSKP1 ، تم إجراء ED 55. تم توضيح مجموعة من المتجهات الذاتية والقيم الذاتية المقابلة من مصفوفة التغاير المائل التي تم الحصول عليها من التقلبات الذرية لمسار MD. تحتوي المتجهات الذاتية على جميع المعلومات المتعلقة باتجاهات النظام في الفضاء المطابق الذي يمثل الحركات الجماعية لجميع الذرات على طول تلك الاتجاهات. تمثل قيم eigenvalues ​​متوسط ​​التقلبات المربعة (MSF) للذرات على طول المتجهات الذاتية المقابلة. في هذه الدراسة ، يتم تحديد أوضاع الحركة الرئيسية من خلال أول اثنين من المتجهات الذاتية للفضاء الفرعي التوافقي الأساسي الذي يُظهر الحركات المنسقة الكبيرة للنظام. تم بناء مصفوفات التغاير لذرات C-Alpha لمسارات VrSKP1 MD وتقطيرها باستخدام برنامج g_covar ضمن برنامج GROMACS. تم استخدام برنامج g_anaeig داخل GROMACS لإسقاط المسارات على المتجهات الذاتية. يتم أخذ عنصرين من أعلى قيمتين من القيم الذاتية لحسابات PCA في الاتجاهين x و y على التوالي للإسقاط ثنائي الأبعاد ويتم رسمهما باستخدام Grace. تم استخدام رموز fortran95 الداخلية لمزيد من تحويلات البيانات ليتم قراءتها بواسطة برنامج GROMACS الوهمي لمشهد الطاقة الحرة Gibbs (FEL). تم استخدام أكواد بيثون الداخلية في مخرجات الصور الخادعة لتحويل الملفات الثنائية إلى ملفات يمكن قراءتها من قبل الإنسان. يتم إجراء التنميط ثلاثي الأبعاد في شكل رسوم بيانية لاختلافات الطاقة الحرة والرسم البياني ثلاثي الأبعاد باستخدام رموز Python و matplotlib و numpy في دفتر Jupyter.

بناء ناقل ثنائي مكدس الجينات وتعبئة pBi121 / VrSKP1-1-GUS في أغروباكتريوم توميفاسيانز EHA105

تم إنشاء بلازميد مؤتلف عن طريق استعادة وربط البلازميد pBi121 و SKP1-1 المستنسخين في ناقل pGMT بعد تقييد الهضم مع XbaI و BamHI تحت سيطرة CaMV35S بالتتابع مع VrSKP1-1 قبل GUS باعتباره الجين المراسل الذي تم تأكيده باستخدام PCR و الهضم في ه. القولونية. في وقت لاحق ، تم تعبئته في الأورام الجرثومية EHA105 عن طريق طريقة التجميد والذوبان 56 وتسمى pBi121 / VrSKP1-1-GUS. مستعمرة واحدة منتقاة من طازجة الأجرعية الثقافات التي تحمل ناقلات البلازميدات pBi121 / VrSKP1-1 مع المضادات الحيوية المناسبة مثل kanamycin (50 & # x02009mg / L) ، ريفامبيسين (75 & # x02009mg / L) نمت في YEM مرق في 28 & # x02009 & # x000b0C لمدة 2 & # x020133 يومًا عند 220p # x0m . تم حصاد مزرعة الخلية ونقلها إلى مرق YEM طازج (10 & # x0201320 & # x02009ml) جنبًا إلى جنب مع المضادات الحيوية المناسبة بعد أن وصلت الخلية إلى المرحلة الأسية (أو السجل) واستخدامها لتحويل النبات.

تحويل Mungbean باستخدام نسيج قمي في بلانتا طريقة GUS والمقايسة النسيجية

بذور الخامس. يشع تم تعقيم سطحها وإنباتها في ألواح بتري مبللة لمدة يومين. تم صنع مجموعتين من النباتات وتم تصنيفها على أنها C (تحكم - غير محولة وتحولت تحكمًا) و T (تم تحويلها إلى معالجة). بعد الإنبات ، تم إجراء إصابة جذرية بمشرط حاد في بذور نبتة الفاصوليا. الأجرعية تم تحضير ثقافة التعليق التي تحتوي على VrSKP1-1-GUS تحت سيطرة مروج CaMV35S عن طريق الطرد المركزي في درجة حرارة الغرفة لمدة 10 & # x02009 دقيقة عند 5000 & # x02009rpm والمزيد من إعادة تعليق الحبيبات في 10 & # x02009ml YEM (OD & # x02009 = & # x020090 .4 & # x020130.6). تم تقليب بذور المانجو في المعلق لمدة ساعتين ثم غسلها بواسطة سيفوتاكسيم. بعد التجفيف الرطب في مناديل ورقية لمدة يومين آخرين ، تم وضع البذور مرة أخرى في اللوحة الأصلية. مجموعة أخرى من بذور mungbean خضعت لـ 3 & # x02009 ساعات من معاملة 20٪ PEG & # x00026 ثم سمح لها بالإنبات. بعد الإنبات ، تم استخدام بعض البذور (محلول PEG-غير متحولة ، محوّل تحكمي ، معالج بنسبة 20٪) لمقايسة GUS بينما تم نقل بعضها مباشرة إلى التربة. تم إجراء فحوصات كيميائية نسيجية لنشاط GUS على البذور النابتة ، والجذر الفلقي للنباتات المحورة وراثيا المفترضة وأوراق نبات الإكسبلانت المتكاثر الذي يبلغ من العمر أسبوعًا واحدًا للتعبير العابر والمستقر لجين GUS. تم جمع النباتات المستأصلة من نبات الفلقة وغمرها في 20 & # x02009 مل من الركيزة GUS (1M فوسفات الصوديوم pH 7 / Triton-X 20٪ / X-Gluc / ماء). ثم غُطيت بذور المانج بورق الألمنيوم ووضعت في حالة مظلمة لتحتضن لمدة 48 & # x02009 ساعة عند 37 & # x02009 & # x000b0C. تم شطفه بعد ذلك في 75٪ كحول مرتين أو ثلاث مرات لإزالة الكلوروفيل 57. تظهر أنسجة النباتات الإيجابية المعدلة وراثيا اللون الأزرق غير القابل للذوبان من النيلي ثنائي كلورو ثنائي البروم. تم استخدام التعبير الجيني المراسل العابر كمؤشر للتعبير عن نصوص SKP1-1.

تحليل احصائي

تم تحليل البيانات التي تم الحصول عليها من التقدير الكيميائي الحيوي عن طريق تحليل التباين (ANOVA) باستخدام حزمة الكمبيوتر الإحصائية Statistix Ver. 8.1 اختبار Duncan متعدد المدى (ص& # x02009 & # x02264 & # x020090.05) لمتوسط ​​الفصل داخل المعالجات والأصناف.

لتحليل مستويات التعبير النسبي للصنف في علاج أحادي الاتجاه تم إجراء ANOVA. في أسس مماثلة ، تم إجراء اختبار t لمقارنة مستويات التعبير النسبي لـ SKP1 في الأصناف داخل / بين المعالجات لأجزاء النبات المختلفة. تم تقدير الفروق داخل المعالجات والأصناف باستخدام اختبار Duncan متعدد المدى (ص& # x02009 & # x02264 & # x020090.05)


شكر وتقدير

تم دعم MK من قبل منحة في المعونة للبحث العلمي (رقم 19036026) ، PRESTO من JST ، ومشروع البحث الاستراتيجي لـ YCU (رقم K20008). تم دعم TN من خلال منحة في المعونة للبحث العلمي (رقم 2057011) ومشروع البحث الاستراتيجي لجامعة YCU (رقم W20011). تم دعم هذه الدراسة بمنحة مساعدة لأبحاث التكنولوجيا العالية (HTR) من وزارة التعليم والعلوم والرياضة والثقافة باليابان ، ومنح بحثية من مؤسسة العلوم الإنسانية (HIV-K-14719) ، وهي منحة -in-Aid لأبحاث الإيدز من وزارة الصحة والعمل والرفاهية ، اليابان (H17-AIDS-002) ، ومبادرة RIKEN الهيكلية للجينوميات / البروتينات (RSGI) ، والمشروع الوطني للتحليلات الهيكلية والوظيفية للبروتين ، وزارة التربية والعلوم والرياضة والثقافة ، اليابان.


شكر وتقدير

يتم تمويل دراسة فرامنغهام للقلب من خلال عقد المعاهد الوطنية للصحة N01-HC-25195. تم تمويل العمل المخبري لهذا التحقيق من قبل قسم البحوث داخل الجسد ، والمعهد القومي للقلب والرئة والدم والمعاهد الوطنية للصحة (دكتور دانيال ليفي) ومنحة المعاهد الوطنية للصحة K08HL121671 (د. مينا مادهور). تم تمويل المكون التحليلي لهذا المشروع من قبل قسم الأبحاث داخل الجسد ، المعهد القومي للقلب والرئة والدم ، ومركز تكنولوجيا المعلومات ، والمعاهد الوطنية للصحة ، بيثيسدا ، دكتوراه في الطب (دكتور دانيال ليفي) ، وجمعية القلب الأمريكية منحة تطوير العلماء 13SDG17290032 (د. شيا يانغ).


الملخص

تمتلك الدورات الكبيرة لمحاكاة الببتيد القدرة على تنظيم الأهداف العلاجية الصعبة. الهياكل من هذا النوع ذات الأشكال الدقيقة والطابع الشبيه بالعقاقير مرغوبة بشكل خاص ، ولكن يصعب نسبيًا تركيبها. طور مختبرنا طرقًا قوية تدمج وحدات الببتيد الصغيرة في السقالات المصممة. تخلق هذه الطرق دورات كبيرة وتدمج دورات غير متجانسة مكثفة لتنويع النتائج وتحسين الخصائص الدوائية. النطاق الافتراضي للمنهجية واسع ويفوق بكثير قدرة تنسيقنا التجريبي. نحن الآن نصف عرضًا حسابيًا لمنهجيتنا التي تخلق مكتبة ثلاثية الأبعاد في سيليكو للدراجات الكبيرة الببتيدية المركبة. أنشأت منصتنا مفتوحة المصدر ، CPMG (مُولِّد دورة ماكروسيكل الببتيد المركب) ، بطريقة حسابية مكتبة تضم 2020794198 دورة كبيرة يمكن أن تنتج عن تسلسل التفاعل متعدد الخطوات الذي قمنا بتطويره. يتم إنشاء الهياكل بناءً على تفاعل الموقع المتوقع ويتم تصفيتها على أساس الخصائص الفيزيائية وثلاثية الأبعاد لتحديد المركبات المتنوعة إلى أقصى حد لتحديد الأولويات. لتحليلات التوافق ، نقدم أيضًا ConfBuster ++ ، وهو منفذ RDKit لبرنامج ConfBuster مفتوح المصدر ، والذي يسمح بالتكامل السهل مع CPMG والتوازي الجاهز لتحسين قابلية التوسع. يسبر نهجنا بعمق مساحة الترابط التي يمكن الوصول إليها عبر منهجيتنا التركيبية ويوفر موردًا للفحص الافتراضي على نطاق واسع.

تم التعرف على المركبات الحلقية الكبيرة على أنها مثبطات إنزيم ، مثل ناهضات ومناهضات GPCR (مستقبلات مقترنة بالبروتين G) ، ومثبطات لتفاعلات البروتين والبروتين ، وكمعدلات لمختلف المسارات البيولوجية الأخرى. تساهم الهياكل الحلقية للدراجات الكبيرة في التنظيم المسبق الهيكلي ، وتخفيض العقوبات الحتمية للالتزام بالأهداف البيولوجية (1 –3). تعتبر الدورات الكبيرة المشتقة من الببتيد جذابة بشكل خاص لاستهداف أسطح البروتين لأن الببتيد المدمج يمكن أن يحاكي بنية البروتين الأصلي وعناصر التعرف (4 ، 5). أدى ظهور العديد من منصات التخليق الحيوي عالية الإنتاجية إلى تحويل الببتيدات الحلقية الكبيرة إلى طريقة قوية لاكتشاف الروابط الترابطية (6 ⇓ ⇓ –10). ومع ذلك ، لا تزال هناك تحديات رئيسية (11). في الأربعين عامًا التي انقضت منذ اكتشاف السيكلوسبورين كدواء نافذ للغشاء ومتوفر بيولوجيًا عن طريق الفم ، حققت الجهود المبذولة لتوقع الهياكل ذات الصلة ذات الخصائص المماثلة نجاحًا محدودًا (12). ومع ذلك ، ظهرت بعض الاتجاهات العامة. يشير التحليل التجريبي للبيانات إلى أن الدراجات الكبيرة لها وزن جزيئي (MW) & لتر 1،000 دا ، إجمالي مساحة السطح القطبية (TPSA) & lt 250 2 ، جlogP & lt 10 ، وأقل من خمسة متبرعين لسندات الهيدروجين من المرجح أن يكونوا متوفرين بيولوجيًا. كما تم الاستشهاد بالشكل الجزيئي وديناميكيات التوافق كعوامل مهمة لتحقيق هذه الغاية (2،12 ⇓ -14).

يسعى مختبرنا إلى تحديد الإعدادات الهيكلية التي يمكن فيها للدراجات الكبيرة الاحتفاظ بالمجموعات القطبية المساعدة مع تحقيق توازن مفيد بين نفاذية الخلية والذوبان المائي (الشكل 1). لقد قمنا بتصميم كواشف السقالات التي يمكن دمجها بسهولة في هيكل الببتيد لتوفير روابط حلقية متنوعة وأشكال حلقية غير متجانسة مضمنة (15 ⇓ ⇓ ⇓ –20). وقد ثبت أن هذه الميزات الهيكلية تعمل على تحسين الارتباط المستهدف ، والقدرة على عرض الأغشية الدهنية بشكل سلبي ومقاومة التحلل البروتيني (12). تستخدم منهجيتنا قوالب تفاعلية مضاعفة ، ش 1G3، والتي يتم تفعيلها على مراحل لتتفاعل مع البولي أميدات غير المحمية لتكوين المركبات الحلقية الكبيرة (الشكل 1). تم تصميم المنهجية للسماح بالتغيير المنهجي لطوبولوجيا المنتج وخصائصه من خلال إشراك مجموعة واسعة من المجموعات الوظيفية الببتيدية الأصلية في تفاعلات تكوين الرابطة بين الكربون والذرة والكربون والكربون. أظهرت دراساتنا التجريبية تلك القوالب ش 1G3 إشراك السلاسل الجانبية العطرية (بما في ذلك على سبيل المثال لا الحصر الفينول ، الإندول ، والإيميدازول) على البولي أميد للمشاركة في ألكلة فريدل كرافتس ، بدائل الأليك المحفزة بالمعادن (المعروفة أيضًا باسم تفاعلات تسوجي - تروست) ، و ن-الأسيليمينيوم الأيونات بوساطة cyclizations (15 ⇓ ⇓ ⇓ –20). على سبيل المثال ، يوفر التحفيز الكلي تحت Pd 0-catalysis دورات كبيرة مرتبطة بـ C-O أو C-N ، حيث يمكن التبديل بين الانتقائية الكيميائية بإضافة Cs2كو3 (1 أو 2). ينتج عن عملية التدوير الكبيرة تحت الظروف الحمضية منتجات مرتبطة بـ C-C (39) عن طريق الاستبدال العطري الإلكتروفيلي (EAS) ، والذي يتضمن العديد منها أيضًا أشكالًا متعددة الحلقات عبر انتقائي متسلسل ن- دورة أيونات أسيليمينيوم للسلسلة الجانبية P1 جنبًا إلى جنب مع التدوير الكبير (46, 9). G3 قادر على المشاركة في نفسه ن- تفاعلات EAS المعززة بأيونات الأسيليمينيوم في حالة عدم وجود سلسلة جانبية عطرية في P1 لإنتاج هياكل مثل 78. رد فعل ش 1 و G2 مع Trp-Trp-Tyr ينتج ن- الأسيليمينيوم إندوبيرولويندولين الجسر بوساطة أيون 3 و 5.

النتائج التخطيطية والتمثيلية المعممة لمنصة التوليف الخاصة بنا. يشار إلى القوالب باللون الأزرق وقلة القلة باللون الرمادي.

ضمن أنماط التفاعل الراسخة المتمثلة في ش 1G3، تصورنا منصة ، حيث يمكن توسيع المنهجية لتشمل نطاقًا أوسع بكثير من القلة قليلة. سيتم تجميعها ليس فقط من الأحماض الأمينية α ، ولكن أيضًا الأحماض الأمينية β2- و 3 في كل من الأشكال المتشابهة. يمكن أن تحتوي السلاسل الجانبية على هذه المونومرات على دورات غير متجانسة متنوعة شبيهة بالمخدرات ، تم اختيارها بسبب قابليتها للتفاعل من خلال ش 1G3. يمكن أن توفر مثل هذه التعديلات مزايا خاصية على منتجات طرق التخليق الحيوي التي تنشأ إلى حد كبير من الأحماض الأمينية الطبيعية. قدمت هذه التجربة الفكرية تحديًا فريدًا - فالنتائج المحتملة فاقت بكثير قدراتنا التجريبية. لذلك لجأنا إلى العرض الحسابي لمنصة التوليف الخاصة بنا (الشكل 2) لتقييم نطاق نتائج التفاعل بشكل منهجي. هنا نصف برنامجنا ، CPMG (مولد دورة Macrocycle المركب الببتيد) ، والذي استخدمناه لإنشاء مكتبة في silico من 2 مليار دورة كبيرة مركبة ناتجة عن تسلسل تفاعل متعدد الخطوات. لقد قمنا أيضًا بتكييف طرق البحث المطابقة (21) لإنشاء Confbuster ++ ، والتي يمكنها إنشاء مطابقة ثلاثية الأبعاد (3D) لأعضاء المكتبة بسرعة. الهدف النهائي لهذا العمل هو تمكين اكتشاف الترابط الافتراضي لأهداف بروتينية متنوعة ذات خصائص هيكلية.

عرض حسابي لمنصة التوليف الخاصة بنا.


الخصائص التوافقية لقوالب الببتيد الحلقية لتصميم البروتين

باسكال دومي ، إيان إم إيغلستون ، ستيليان نيكولا ، جينارو إسبوزيتو أنا ومانفريد موتر

معهد الكيمياء العضوية ، جامعة العلوم ، لوزان ، سويسرا , أنا قسم العلوم والتكنولوجيا ، جامعة أوديني ، أوديني ، إيطاليا

تمثل القوالب الطوبولوجية القابلة للعنونة بشكل انتقائي ميزة رئيسية في تصميم de novo للبروتينات باستخدام مفهوم TASP (البروتينات الاصطناعية المجمعة بالقالب). لقد وصفنا مؤخرًا الأساليب التركيبية للعنونة الانتقائية القابلة للعنونة (المحمية بشكل متعامد) المحتوية على اللايسين الحلقية (جزيئات RAFT) كقوالب لتخليق TASP. نقوم الآن بالإبلاغ عن الدراسات التوافقية لهذه الجزيئات من خلال طرق الديناميكيات الجزيئية والرنين المغناطيسي النووي. توضح هذه النتائج وجود هياكل بيتا تشبه ورقة بيتا والتي تم التنبؤ بها للقوالب المحددة جيدًا بشكل جيد. يتم تسهيل دراسات الرنين المغناطيسي النووي من خلال الوصول إلى الجزيئات التي تحتوي على العديد من اللايسينات المحمية تفاضليًا والتي تعمل على إزالة انحطاط التسلسل.

نقوم أيضًا بمقارنة النتائج التي تم الحصول عليها باستخدام القوالب الببتيدية البحتة مع تلك الموجودة في القوالب التي تتضمن محاكاة دوران بيتا من أجل تحسين هذه الأشكال الهيكلية بشكل أكبر. فائدة هذا النهج في التصميم بداهة ستتم مناقشة بنية هذه الببتيدات الحلقية المقيدة جنبًا إلى جنب مع التطبيقات الجديدة المحتملة لجزيئات RAFT في التعرف الجزيئي والتوليف التوافقي.

تُستخدم الآن القوالب الطوبولوجية التي تحتوي على مجموعات وظيفية محددة مكانيًا على نطاق واسع في تصميم بروتين دي نوفو واكتشاف الدواء 1 أ-ي. من حيث المبدأ ، يمكن استخدام أي نظام يمكن أن يقدم مجموعة ثابتة من الوظائف ، ولكن في سياق تصميم de novo ، فإن أشكال الببتيد المقيدة بالتوافق تكون مثيرة للاهتمام بشكل خاص. في نهج TASP (البروتينات الاصطناعية المجمعة بالقالب) 2 ، يتم إرفاق وحدات البنية الثانوية الببتيدية البرمائية بقالب peptidic الذي يعمل على توجيه وتوجيه الأول إلى طبولوجيا قابلة للطي المرغوبة. تحقيقا لهذه الغاية ، ركز عدد من الدراسات من مختبرنا على استخدام الديابيبتيدات الحلقية المحتوية على ليسين 3 بالشكل العام الموضح في الشكل 1.كان من المتوقع أن توفر هذه الجزيئات أنظمة نموذجية محددة جيدًا بناءً على نوعين مرتبطين من النوع الثاني بيتا ، عن طريق القياس مع أنظمة مثل المضاد الحيوي لعزل الببتيد الدوري الذي يحدث بشكل طبيعي ، الجراميسيدين S 4. احتوت جزيئات القوالب هذه في البداية على نوع واحد فقط من حماية السلسلة الجانبية ليسين ، ويرجع ذلك جزئيًا إلى الصعوبة الموجودة في تحضير الببتيدات الحلقية بأكثر من مجموعة حماية متعامدة 5 بواسطة طرق ببتيد طور المحلول. ومع ذلك ، فإن التطبيقات الجديدة لهذه القوالب ، لا سيما في الكيمياء التوافقية ، تتطلب أنظمة بها عدة مواقع قابلة للعنونة بشكل انتقائي وبالتالي سلاسل جانبية محمية تفاضليًا. لقد وصفنا مؤخرًا طريقًا موجزًا ​​للقوالب الطوبولوجية من هذا النوع والتي تستخدم كلاً من المرحلة الصلبة وتخليق الببتيد المحلول لتحقيق قدر أكبر من المرونة والكفاءة في تحضير مشتقات الببتيد الحلقي بأعداد غير مسبوقة حتى الآن من مجموعات الحماية المتعامدة أو المواقع القابلة للعنونة بشكل انتقائي. نحن نطلق على هذه الجزيئات القوالب الوظيفية القابلة للعنونة بشكل منطقي (RAFT) 6.

طوف الجزيئات (القوالب الوظيفية القابلة للعنونة رجعيًا)
تمثل قوالب ببتيدية تحتوي على أحماض أمينية ثلاثية الوظائف
التي يمكن معالجة سلاسلها الجانبية بشكل انتقائي بفضل تقنيات الحماية المتعامدة
أو تفاعل كيميائي فريد. صأنا = وظيفة قابلة للعنونة
.

كما لوحظ سابقًا ، تم استنتاج مطابقة هذه الجزيئات في البداية من اعتبارات تسلسل الأحماض الأمينية. بصرف النظر عن دراسة الديناميكيات الجزيئية 7 على الببتيدات وثيقة الصلة ، لم يتم إجراء دراسة مباشرة حول القضية المهمة المتعلقة بهيكل حل RAFT. من الصعب جدًا بالفعل دراسة القوالب التي تحتوي على نوع واحد فقط من حماية السلسلة الجانبية باستخدام طرق NMR نظرًا لأن تناسقها العالي يؤدي إلى فقد كبير في المعلومات. الآن مع سهولة الوصول إلى RAFT مع مواقع السلسلة الجانبية المميزة ، تمكنا لأول مرة من إجراء تحقيقات مطابقة للرنين المغناطيسي النووي والديناميكيات الجزيئية ، والتي تزودنا بمعلومات قيمة من أجل التحسين المستمر وتطبيق RAFT في الكيمياء العضوية الحيوية.

متواليات decapeptide الخطية المقابلة لجزيئات RAFT 1-3 تم تجميعها عن طريق تخليق الببتيد في المرحلة الصلبة 8 وفقًا لاستراتيجية Fmoc 9. تم استخدام وحدة رابط راتينج عالية القابلية للتغير الحمضي (Sasrin 10) ، مما يسمح بفصل الببتيدات المكتملة من راتنج الطور الصلب في ظروف معتدلة للغاية ، مع 1٪ TFA في DCM. أعطت الظروف المعتدلة في كل من تجميع الببتيد وانقسامه من الدعم الصلب درجة المرونة اللازمة لدمج مجموعات حماية سلسلة جانبية مختلفة قابلة للكسر بواسطة الحمض (Boc) ، القاعدة (Fmoc) ، Pd (II) (Aloc 11) ، أو nucleophiles (Dde 12). طوف 1-3 تم الحصول عليها لاحقًا عن طريق تحلل الببتيدات الخطية في DMF مع PyBOP 13 في ظل ظروف التخفيف العالي. كان تفاعل التدوير فعالًا بشكل ملحوظ ، حيث اكتمل في حوالي 30 دقيقة مع وجود فائض طفيف فقط من كاشف الاقتران ، وإعطاء RAFT المطلوب في عائد جيد إلى ممتاز بعد ترسيب بسيط (انظر الجدول 1). تتناقض هذه النتائج مع تلك التي لوحظت عادةً في دورات الببتيد حيث تكون أوقات التفاعل الطويلة والكواشف الزائدة مطلوبة عادةً 14،15 ، وربما تعكس المطابقات شبه الدورية المفضلة 16 في المتواليات الخطية لموضع التدوير المختار.

الجدول 1. ينتج التدوير لتخليق جزيئات RAFT

كما يتضح من الشكل 1 ، RAFT 1 يقدم تمايزًا كاملاً بين السلاسل الجانبية الأربعة لليسين ، بينما 2 و 3 تسمح بالتمييز الثنائي ، إما على نفس الوجه (2) أو الوجه المعاكس (3) من الدورة. يوضح المخطط 1 كيف يمكن معالجة هذه القوالب بشكل انتقائي في الممارسة العملية لحالة 1. وبالتالي ، فإن نزع الحماية الانتقائي والأسيل كما هو موضح يسمح للمرء بمعالجة وتعديل السلاسل الجانبية الأربعة اللايسينية بشكل انتقائي ، مما يوفر احترام الترتيب المناسب. إن RAFT المعدل الناتج هو لبنة بناء محتملة لتصميم البروتين الجديد وتوليف TASP ، يمكن استخدام الوظائف الملحقة حديثًا للربط الانتقائي للببتيدات غير المحمية وفقًا لما يسمى بطرق الربط الانتقائية الكيميائية 17.


مخطط 1. نزع الحماية الانتقائية وتعديل RAFT 1

تم تسجيل أطياف الرنين المغناطيسي النووي ذات البعد الواحد والثنائي الأبعاد بشكل عام في DMSO-d6 على مطياف Bruker AMX600 يعمل بسرعة 600.130 ميجا هرتز. تم تحقيق تخصيصات الرنين باستخدام تجارب DQF-COZY 18 و TOCSY 19 ، ثم تم استخراج التخصيصات المتسلسلة عن طريق فحص الوصلات ثنائية القطب في أطياف NOESY 20-21. كان المظهر العام للأطياف ثنائية الأبعاد لجميع المركبات الثلاثة هو نفسه المتوقع من التشابه الهيكلي. تم تراكب أنظمة الدوران فقط لبقايا البرولايل (1،6) في الجزيئات الثلاثة. في الواقع ، نتيجة للحماية الجانبية التفاضلية للسلسلة وبالتالي انخفاض التماثل في 1-3، يمكن دائمًا تمييز مجموعتين متميزتين من رنين اللايسين (Lys 5 و Lys 10 ، قبل Lys 3 و Lys 8 ، بعد الجلايسين). يظهر هذا بوضوح شديد من خلال منطقة بصمة الإصبع (NH) في أطياف NOSY 1 و 2 (الشكل 2). في حالة المركب 1، تسمح إزالة المزيد من التناظر باستخراج المزيد من المعلومات ، أي التحديد الكامل لجميع أنظمة دوران ليسين الأربعة بدلاً من اثنين فقط كما هو الحال في C2 قوالب متماثلة 2 و 3.

الشكل 2. منطقة بصمات الأصابع من طيف NOESY من 1 (يسار) و 2 (يمين) يُظهر بشكل أساسي التوصيلات ثنائية القطب HN-H (ألفا).

توضح بيانات NOE أيضًا أن جميع روابط الببتيد في القوالب عابرة. بالنسبة لبقايا البرولايل ، يظهر ذلك بواسطة NOE بين H (alpha) Lys 5/10 و H (delta) Pro 6/1. كان من الممكن أيضًا إجراء التخصيصات الأولية للبرولين بيتا وبروتونات دلتا باستخدام شدة interproton NOE النسبية بين الأول وبروتونات H (ألفا). بالنسبة للبروتونات المتشابهة لبقايا الجلايسيل لـ 1، تم الحصول على تخصيص خاص الفراغ باستخدام بيانات NOE داخل وبين المقيم وقيم اقتران J المستمدة من تجارب انتقائية (SOFT COZY). سمح لنا ذلك بإصلاح قيم زاوية الالتواء psi بشكل لا لبس فيه لبقايا الجلايسيل على أنها حوالي 0 درجة. هذه هي القيمة المتوقعة لـ glycine 23 في الزاوية (i + 2) موضع منعطف من النوع II beta.

مزيد من الأدلة على موقع وحدات Pro-Gly في تكوين cisoid من النوع II يأتي من الاتصال المناسب بين Pro 1/6 C = O و Gly 2/7 H (alpha) في طيف HMQC 24 من 1. أيضًا ، يشير تحليل اعتماد درجة الحرارة على التحولات الكيميائية لأميد NH4 إلى أن جميع المخلفات بخلاف Pro أو Gly تشارك في الترابط الهيدروجيني. يشير هذا إلى نموذج ورقة بيتا مضاد للتوازي مرتبط عند أطرافه بدورتين بيتا ، والذي كان مبدأ التصميم الأصلي لأنظمة RAFT الخاصة بنا.

الصورة النوعية للهيكل الثانوي لـ 1-3 يمكن أيضًا الحصول عليها باستخدام التحليل الطيفي للقرص المضغوط 25. يوضح الشكل 3 أطياف القوالب الثلاثة المسجلة في الأسيتونيتريل عند 22 درجة ، مما يشير إلى أنه بشكل عام يمتلك الأول نفس التشكل المستقر. شكل منحنيات القرص المضغوط مع تأثير قطني سلبي حوالي 224 نانومتر وشريط موجب حول 192-197 نانومتر يتوافق مع وجود هياكل من النوع الثاني من دورة بيتا. المنحنيات تقترب من الشكل المتوقع لطيف من الفئة B في الوصف النظري لـ Woody 26 ، على الرغم من أن الحد الأقصى الموجب يتحول إلى حد ما إلى اللون الأزرق مقارنة بالحالة المثالية. مواقفهم هي في الواقع أكثر نموذجية من تلك المتوقعة لطيف من الفئة أ ، والذي يتوافق مع ورقة بيتا خالصة. إضافة الماء حتى 50٪ (الشكل 3 ، اليمين) ليس له تأثير كبير على الأطياف المسجلة في الميثانول ، والتي ربما يمكن اعتبارها دليلاً نوعياً إضافيًا على الاستقرار المطابق لهذه RAFT في المحلول. ومن المثير للاهتمام على الرغم من ذلك ، عندما RAFT 2 جزئيًا عن طريق المعالجة بالحمض ، يتغير طيف القرص المضغوط بشكل ملحوظ (الشكل 4). في ماء الميثانول أو الماء ، لم تعد الأطياف تحتوي على ميزات كل من ورقة بيتا وأطياف الدوران بيتا. يتم إزاحة الحد الأقصى الموجب لـ pi-pi * باللون الأحمر إلى حوالي 205-208 نانومتر مع كون النطاق السالب n-pi * غير متحرك بشكل أساسي عند 224 نانومتر ، وهي خصائص منعطف بيتا النقي أو طيف الفئة B. يعكس هذا زيادة في المرونة الحركية للقالب وبعض الخسارة المصاحبة للبنية الثانوية في الماء (أي مساهمة ورقة بيتا) والتي تتوافق بشكل جيد مع نتائج الرنين المغناطيسي النووي التي تم الحصول عليها لهذا النظام 27.

الشكل 3. طيف القرص المضغوط من 1, 2 و 3 بوصة3طيف CD (يسار) CN من 1, 2 و 3 في MeOH / H2آه أنت محق).

الشكل 4. طيف القرص المضغوط لـ (DesBoc) -2 في MeOH / H2O و H.2ا

بناءً على نتائج الرنين المغناطيسي النووي ، كان هيكل البداية لمحاكاة الديناميكيات الجزيئية عبارة عن نظام به دورانان من نوع Pro-Gly من النوع الثاني بيتا متصلين بواسطة اثنين من أشكال Lys-Ala-Lys ثلاثية الببتيد في شكل موسع. تم توجيه السلاسل الجانبية لليسين والألانين نحو الوجوه المعاكسة للدورة ، وهو التكوين المطلوب أصلاً وأيضًا ما يتوافق مع نتائج الرنين المغناطيسي النووي. للمحاكاة مع 1، تم تطبيق قيود المسافة التي تم تقييمها من معدلات تراكم NOE 28 بشكل رئيسي على هيدروجين العمود الفقري للببتيد ، على الرغم من تضمين فصل ليسين ألفا-بيتا أيضًا. من أجل تجنب الأخطاء من تأثيرات نقل التماسك 29 ، تم حساب مسافات NH-H (alpha) الداخلية من ثوابت اقتران J NH-H (alpha) المقابلة بدلاً من القمم المتقاطعة NOSY 30. أخيرًا ، بالإضافة إلى المسافات المشتقة من NOE ، تم فرض حدود الفصل لتقييد روابط الهيدروجين التي تم استنتاجها من تحليل NMR.

تم إجراء المحاكاة في الخلاء باستخدام حقل قوة CVFF 31 كما هو مطبق في Discover (BIOSYM Technologies Inc. ، سان دييغو). استخدمت جميع الحسابات ثابتًا عازلًا عيانيًا يعتمد على المسافة يبلغ 2.5 * r وقطعة لانهائية للتفاعلات غير المقيدة للتعويض جزئيًا عن نقص المذيب 32. تم إجراء ديناميكيات جزيئية مقيدة عند 600 كيلو أو 900 كيلو لكل 100 ثانية باستخدام خطوة زمنية نموذجية تبلغ 0.5 ثانية. تم حفظ التكوينات وتقليلها على فترات زمنية قدرها 1ps باستخدام أكثر انحدارًا وخوارزميات التدرج المتقارن. خلال محاكاة 100ps ، لم يلاحظ أي انتهاكات كبيرة لقيود المسافة التجريبية ، ومتوسط ​​rmsd للمسافات 43 المفروضة كان 0.014 angstroms. يُظهر تحليل زوايا العمود الفقري ثنائية الأضلاع (phi ، psi) عبر مسار الديناميكيات أن هناك ميلًا قويًا للتشكيل الممتد في وحدات Lys-Ala-Lys مع دوران من النوع II التجريبي المشوه قليلاً حول مواقع Pro-Gly. يمكن تصور مسار زاوية ثنائي السطوح باستخدام مؤامرة راماشاندران مرتبطة 33 (الشكل 5). يظهر هذا كدالة لرقم الموقع (i) ، قيم أزواج (phi ، psi) المرتبطة بخطوط مستقيمة. بهذه الطريقة ، يكون التوزيع الحاد لأزواج (phi ، psi) واضحًا بشكل فوري ، مما يدل على أن 100 بنية تم إنشاؤها في المحاكاة تنتمي إلى نفس العائلة.


الشكل 5. مؤامرة مرتبطة تمثل تباين الزاوية ثنائية السطوح (phi ، psi ،) على المسار الديناميكي الجزيئي كدالة في التسلسل.

قيم (phi ، psi) التي تم الحصول عليها من أجل اثنين من البقايا البولية (i = 1،6) (انظر الجدول 2) هي سمة من سمات موضع الزاوية i + 1 لدوران بيتا من النوع الثاني (-60 ، 120). من ناحية أخرى ، فإن قيم الجلايسين (phi ، psi) مشوهة إلى حد ما فيما يتعلق بالقيم المثالية من النوع II (80 ، 0) وتتوافق إلى حد ما مع تلك المتوقعة لموضع i + 2 من النوع الخامس (80 ، - 80).


الجدول 2. زوايا العمود الفقري لمتوسط ​​MD وهيكل الطاقة المصغرة لـ 1

يمكن حساب هذه الانحرافات الواضحة عن الهندسة المثالية من النوع الثاني من خلال الاختلافات في قيم أوميغا لكل من البرولينات التي تنحرف بشكل كبير (حوالي 20 درجة) عن قيمة ترانس أميد (180 درجة) التي تنبأ بها الرنين المغناطيسي النووي. حتى عندما تم فرض وظيفة جزائية في المحاكاة لإبقاء روابط البرولين أميد عابرة بدقة ، استمرت هذه القيم. تم الإبلاغ سابقًا عن مثل هذا الانحراف عن السوية بالنسبة لرابطة الأميد بين هيدروكسي برولين والجليسين في دورة بيتا 34. تعرض وحدات Lys-Ala-Lys زوايا تتوافق مع تلك المسموح بها لبنية ورقة بيتا ، على الرغم من وجود قدر معين من التشويه. هذا ليس مفاجئًا تمامًا نظرًا لأن نطاقًا واسعًا من البنية مسموح به ضمن تصنيف ورقة بيتا العام 23 ، ولن يكون من الواقعي على أي حال توقع وجود منعطفين وخيطين تجريبيين مثاليين في مقطوعة ببتيد دوري دون إجهاد كبير.

تحليل البيانات التجريبية التي تم الحصول عليها ل 1-3 تأكد من أن هذه RAFT تتبنى هياكل الحل استنادًا إلى تشكيل صفائح بيتا المضادة للتوازي ، مغلقًا بدورتين بيتا تتمحوران حول ثنائي الببتيدات Pro-Gly. هذا يتفق مع مبدأ التصميم الأصلي المستخدم لتطوير مثل هذه القوالب. تدعم الديناميكيات الجزيئية المقيدة باستخدام القيود المشتقة من الرنين المغناطيسي النووي هذه النتائج. على وجه الخصوص ، تظل السلاسل الجانبية الأربعة اللايسينية دائمًا على الوجه المقابل للدورة إلى الألانين (مركبات 1, 2) أو ليسين (مركب 3). تختلف هذه النتائج بشكل كبير عن تلك الخاصة بدراسة Floegel و Mutter 7 ، حيث تم إجراء عمليات المحاكاة على قوالب مماثلة تحتوي على الجليسين في منتصف وحدات ورقة بيتا (أي الموضعان 4 و 9). في هذه الدراسة ، تم العثور على عدة عائلات من التوافقات المفضلة ، وبعضها يحتوي على سلاسل جانبية ليسين تشير إلى جانبي القالب بطريقة عشوائية.

توفر دراسات الرنين المغناطيسي النووي على القوالب التي تم فيها استبدال ثنائي الببتيدات Pro-Gly بمحاكاة دوران بيتا أيضًا مقارنة مثيرة للاهتمام مع RAFT 35. الأنظمة التي تحتوي على 8-aminomethyl-5،6،7،8-tetrahydro-2-naphtoic acid (AMTA) 3 تُظهر بقايا المحاكاة والجليسيل في ورقة بيتا قدرًا أكبر من المرونة وميلًا لوحدات الدوران للانطواء تجاه بعضها البعض . يمكن أن يُعزى ذلك إلى استبدال الألانين أو اللايسين في RAFT الخاص بنا بالجليسين مما يؤدي بالتالي إلى تشكيل أقل وضوحًا قد يسمح حتى بانعكاس السلاسل الجانبية كما تنبأ به Floegel و Mutter 7. في ضوء ذلك ، يمكن للمرء أن يستنتج أن تصميم المزيد من جزيئات RAFT يجب أن يتجنب استخدام الجلايسين إذا كان سيتم الحصول على نظام صارم توافقيا ، وعلى وجه الخصوص النظام الذي يتم فيه توجيه المواقع القابلة للعنونة بشكل انتقائي حسب الرغبة. وهكذا ، من خلال السماح لنا بالاستنتاج بداهة عزر هيكلي ثانوي شائع للعمود الفقري لنظائر RAFT 1-3، يجب أن يسمح نهجنا المشترك للديناميكيات الجزيئية والرنين المغناطيسي النووي بتصميم RAFT جديد كما هو مطلوب مع تجنب الميزات التي من شأنها تعطيل التشكل المفضل المؤكد.

قد تكتسب الأساليب التي وضعناها لتجميع القوالب القابلة للعنونة بشكل انتقائي أهمية إضافية الآن بعد أن تم تحديد تفضيلاتهم المطابقة وبالتالي توجيه وظائف السلسلة الجانبية التي يقدمونها بدقة. تم بالفعل استخدام قوالب الببتيد الدوري التي تحتوي على أربع مجموعات حماية متعامدة كسقالات لإعداد مكتبات اندماجية بتنسيق مسح موضعي 1e ، f ، لتخليق وتحديد مثبطات الإنزيم أو المركبات ذات النشاط المضاد للميكروبات. بالتالي، 1 مع أربعة مواقع قابلة للعنونة بشكل انتقائي قد يكون لها بعض التطبيقات المفيدة في هذا السياق 36. في سياق مماثل ، تم استخدام مجموعة متنوعة من القوالب الطوبولوجية ، سواء الببتيدية أو غير الببتيدية ، لتقديم مجموعات وظيفية في اتجاهات محددة لدراسات التعرف الجزيئي ، لتقليد مواقع ربط المستقبلات 1 د أو المطابقات النشطة بيولوجيًا ليجاندس الببتيد 1 أ ، ب . طوف 1 و 2 يجب أن تكون مناسبة بشكل مثالي لمثل هذه الدراسات مع النطاق الذي تقدمه للارتباط الانتقائي للوظائف في ترتيب مكاني معروف. في مجال تصميم بروتين دي نوفو أيضًا ، تطبيق واضح لكليهما 1 و 2 سيكون إرفاق وتوجيه كتل الببتيد المختلفة مما يؤدي إلى ظهور جزيئات TASP غير متناظرة جديدة. تم بالفعل إثبات أن مشتقات TASP المتناظرة لها خصائص مناعية مثيرة للاهتمام 38 وإمكانية تخليق قنوات الأيونات الاصطناعية 39 ، وبالتالي فإن توفر RAFT مثل 1 و 2 يجب أن يفتح الطريق لمجموعة واسعة من هذه التطبيقات.

ربما تكون أكثر الاحتمالات إثارة لإعداد أنظمة ذات خصائص بيولوجية أو فيزيائية كيميائية جديدة تقدمها شركة RAFT مثل 3 يتم فيها تمييز الوجوه المتقابلة للجزيء ، مما يسمح بتقديم وظائف "المستجيب" و "المستقبل" بشكل مستقل وتعديلهما على الوجهين. سيسمح هذا للمرء بتضمين الوظائف المحددة للأنظمة "أحادية الوجه" مثل 1 و 2 بمعنى التعرف الجزيئي وتقنيات الاندماج ، في الجزيئات التي يمكن ربطها بالأسطح أو التي يمكن أن تتفاعل مع أغشية الخلايا ، من خلال الاشتقاق المناسب للوجه "السفلي" القابل للتوجيه الانتقائي لـ RAFT. في الحالة الأخيرة على سبيل المثال ، يمكن تحقيق ذلك عن طريق تطعيم الوحدات الدهنية أو الجليكوسيدية في RAFT "ثنائية الوجه" أو "المجالين".

يوفر التحقيق المطابق التفصيلي لجزيئات RAFT معلومات قيمة يمكن تطبيقها في تصميم قوالب طوبولوجية جديدة والتي تتيح لنا تحسين دور RAFT في التطبيقات الحالية ، فضلاً عن تقديم وجهات نظر جديدة لاستخدامها. يخضع هذان الموضوعان المتصلان حاليًا للتحقيق النشط في مختبرنا.

تم دعم هذا العمل من قبل مؤسسة العلوم الوطنية السويسرية.

1 (أ) Hirschmann، R. Nicolau، KC Pietranico، S. Leahy، EM Salvino، J. Arison، B. Cichy، MA Spoors، PG Shakespeare، WC Sprengler، PA Hamley، P. Smith، AB Reisine، T. Raynor، K. Maechler ، إل دونالدسون ، سي فالي ، دبليو فريدينجر ، آر إم كاسيري ، إم آر سترادر ​​، سي دي جيه. تشيم. شركة 1993, 115, 12550-12568. (ب) هيرشمان ، ر. سبرينجلر ، ب.أ.كاواساكي ، ت. ليهي ، جيه دبليو شكسبير ، دبليو سي سميث ، أ. رباعي الوجوه 1993, 49, 3665-3676. (ج) بويس ، آر لي ، جي نستلر ، إتش بي سويناجا ، تي ستيل ، دبليو سي. جيه. تشيم. شركة نفط الجنوب. 1994, 116, 7955-7956. (د) كان ، م. سينليت 1993 821-826. (هـ) Eichler، J. Lucka، A.W Houghten، R. A. الدقة الببتيد. 1994, 7, 300-307. (F) أوستريش ، جيه إم هوسار ، جي إم بلونديل ، إس إي دويرنر ، بي ويبر ، بي إيه هوتن ، آر أ. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 1994, 91, 11138-11142. (ز) ساساكي ، ت. كايزر ، إي ت. جيه. تشيم. شركة 1989, 111, 380-381. (ح) ليبرمان ، إم ساساكي ، ت. جيه. تشيم. شركة 1991, 113, 1470-1471. (أنا) تشوما ، سي تي لير ، جي دي نيلسون ، إم جي داتون ، بي إل روبرتسون ، دي إي ديجرادو ، دبليو إف. جيه. تشيم. شركة 1994, 116, 856-865. (ي) غديري ، إم آر سواريس ، سي تشوي ، سي. جيه. تشيم. شركة نفط الجنوب. 1992, 114, 825-831.

2. موتر ، إم فوليمير ، س. انجيو. تشيم. كثافة العمليات إد. إنجل. 1989, 28, 535-554.

3. إرنست ، آي كالفودا ، جيه سيجل ، سي.ريس ، جي فريتز ، إتش بلومرز ، إم راشدورف ، إف فرانكوت ، إي موتر ، إم. هيلف. شيم. اكتا 1993, 76, 1539-1563.

4. DeSantis، P. Liquori، A. M. البوليمرات الحيوية 1971, 10, 699-710.

5. باراني ، جي ميريفيلد ، ر. ب. جيه. تشيم. شركة نفط الجنوب. 1977, 99, 7363-7365.

6. دومي ، بي إجليستون ، آي إم سيرفيجني ، إس سيلا ، يو صن ، إكس موتر ، إم. رباعي الوجوه ليت. 36, 1255-1258.

7. فلويجل ، آر. موتر ، إم. البوليمرات الحيوية 1992, 32, 1283-1310.

8. ستيوارت ، جيه إم يونغ ، جيه د. 1984 "تخليق الببتيد في الطور الصلب" (الطبعة الثانية). شركة بيرس كيميكال ، روكفورد ، إلينوي.

9. أثرتون ، إي شيبارد ، ر. 1989 "تخليق الببتيد في المرحلة الصلبة: نهج عملي". مطبعة IRL في مطبعة جامعة أكسفورد.

10. ميرغلر ، إم تانر ، ر. جوستيلي ، ج. جريج ، ب. رباعي الوجوه ليت. 1988, 29, 4005-4008.

11. Guibe ، F. Dangles ، O. Balavoine ، G. Loffet ، A. رباعي الوجوه ليت. 1989, 30, 2641-2644.

12. بيكروفت ، بي دبليو تشان ، دبليو سي تشابرا ، إس آر هون ، إن دي. J. كيم. شركة نفط الجنوب. تشيم. كومون. 1993, 778-779.

13. كوست ، ج.لينجوين ، د. كاسترو ، ب. رباعي الوجوه ليت. 1990, 31, 205-208.

14. كوبل ، ك. J. فارم. علوم. 1972, 61, 1345-1356.

15. كروسي ، إي هويرتا ، جي إم أندرو ، دي جيرالت ، إي. رباعي الوجوه ليت. 1990, 31, 4191-4194.

16. تمتم ، م. جيه. تشيم. شركة نفط الجنوب. 1977, 99, 8307-8314.

17. كان ، إل إي فيري داماري ، بورلي ، إس كيه كينت ، إس بي إتش. جيه. تشيم. شركة نفط الجنوب. 1995, 117، 2998-3007 Shao، J. Tam، J. P. جيه. تشيم. شركة نفط الجنوب. 1995, 117، 3893-3899 هيلفيرت ، د. الكيمياء والبيولوجيا 1994, 1, 201-203.

18. بينتيني ، ف.سورنسن ، أو.و.إرنست ، ر. جيه. تشيم. شركة نفط الجنوب. 1982, 104, 6800-6801.

19. براونشويلر ، إل إرنست ، ر. جيه. ماجن. ريسون. 1983, 53, 521-528.

20. جينر ، ج.ماير ، ب. هـ. باديمان ، ب. إرنست ، ر. J. كيم. فيز. 1979, 71, 4546-4553.

21. Wuthrich ، K. 1987 "التحليل الطيفي بالرنين المغناطيسي النووي للبروتينات والأحماض النووية". وايلي ، نيويورك.

22. Bruschweiler ، R. Griesinger ، C. Sorensen ، O. W. Ernst ، R. R. جيه. ماجن. ريسون. 1988, 78, 178-185.

23. روز ، جي دي جييراش ، إل إم سميث ، جيه إيه. حال. بروتين كيم. 1985, 37, 1-109.

24. فريمان ، ر. موريس ، ج. أ. J. كيم. شركة نفط الجنوب. تشيم. كومون. 1978, 684-686.

25. وودي ، ر. 1985 في "الببتيدات" ، المجلد 7 ، ص 16-115. إد. هروبي ، ف.جيه أكاديميك برس ، نيويورك.

26. وودي ، ر. 1974 في "الببتيدات ، عديد الببتيدات والبروتينات" ، الصفحات من 338 إلى 350. محرران. Blout ، E.R Bovey ، F.A Goodman ، M. Lotan ، N. Wiley ، New York.

27. عندما يكون طيف الرنين المغناطيسي النووي محميًا جزئيًا 2 تم تسجيله في D.2O ، لم يعد بالإمكان تحديد خصائص التوصيلات NOE المميزة لميزات الدوران التجريبي والورقة التجريبية. هذا يتوافق مع زيادة المرونة الهيكلية لجزيء RAFT.

28. كومار ، أ.فاجنر ، ج. إرنست ، ر.روثريتش ، ك. جيه. تشيم. شركة نفط الجنوب. 1981, 103, 3654-3658.

29. ماكورا ، S. Wuthrich ، K. Ernst ، R. R. جيه. ماجن. ريسون. 1982, 46, 269-284.

30. باردي ، أ.بيليتر ، إم ووثريش ، ك. جيه مول. بيول. 1984, 180, 741-751.

31. هاجلر ، إيه تي هولر ، إي ليفسون ، إس. جيه. تشيم. شركة نفط الجنوب. 1974, 96, 5319-5327.

32. وينر ، إس جيه كولمان ، بي إيه كيس ، دي إيه سينغ ، يو سي جيو ، سي ألاغونا ، جي بروفيتا ، إس. وينر ، بي جي. جيه. تشيم. شركة نفط الجنوب. 1984, 106, 765-784.

33. ماكلين ، آر دي إريكسون ، ب. كثافة العمليات J. الببتيد بروتين Res. 1995, 45, 272-281.

34. جوبا ، و. جيه. تشيم. شركة نفط الجنوب. 1994, 116, 7532-7540.

35. بلومرز ، M. J. J. Ernest ، I. Mutter ، M. نتائج غير منشورة.

36. سيلا ، يو موتر ، م. جيه مول. تعرف 1995, 8, 29-34.

37. توشيرير ، جي دويرنر ، بي سيلا ، يو كامبر ، بي. موتر ، إم. رباعي الوجوه 1993, 49, 3559-3575.

38. توشيرير ، جي سيرفيس ، سي كورادين ، جي بلوم ، يو موتر ، إم. علوم البروتين. 1992, 1, 1377-1386.

39. باولاك ، إم ميسيث ، يو دانابال ، بي موتر ، إم فوغل ، هـ. علوم البروتين. 1994, 3, 1788-1805.


شاهد الفيديو: How to Make a Lei with Hawaiian Airlines Employees (أغسطس 2022).